Biol Reprod Keystone Symposia Conference on Frontiers in Reproductive Biology & Regulation of Fertility.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print September 26, 2007.
Biol Reprod 2007, 10.1095/biolreprod.107.063990
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
78/1/193    most recent
biolreprod.107.063990v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, C.
Right arrow Articles by Sun, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, C.
Right arrow Articles by Sun, K.
Agricola
Right arrow Articles by Guo, C.
Right arrow Articles by Sun, K.
BIOLOGY OF REPRODUCTION 78, 193–197 (2008)
DOI: 10.1095/biolreprod.107.063990
© 2008 by the Society for the Study of Reproduction, Inc.

Paradox of Glucocorticoid-Induced Cytosolic Phospholipase A2 Group IVA Messenger RNA Expression Involves Glucocorticoid Receptor Binding to the Promoter in Human Amnion Fibroblasts1

Chunming Guo 3, Zhen Yang 3, Wenjiao Li 4, Ping Zhu 5, Leslie Myatt 6, and Kang Sun 2 3 6

School of Life Sciences,3 Fudan University, Shanghai 200433, People's Republic of China Maternal and Fetal Care Hospital of Changning District,4 Shanghai 200051, People's Republic of China Department of Obstetrics and Gynecology,5 No. 401 Hospital, Qingdao 266100, People's Republic of China Department of Obstetrics and Gynecology,6 College of Medicine, University of Cincinnati, Cincinnati, Ohio 45267

ABSTRACT

Glucocorticoids (GCs) are well-known anti-inflammatory drugs inhibiting prostaglandin production. Paradoxically, GCs are reported to stimulate cytosolic phosphoplipase A2 group IVA (PLA2G4A) and prostaglandin-endoperoxide synthase 2 (PTGS2) expression in human amnion fibroblasts. This study was designed to examine the molecular mechanisms underlying glucocorticoid-induced PLA2G4A expression in human amnion fibroblasts. Our data showed that cortisol (0.01~1 µM) increased PLA2G4A mRNA level in a dose-dependent manner in human amnion fibroblasts, which was blocked by glucocorticoid receptor antagonist RU486 (1 µM) as well as by the mRNA transcription inhibitor 5,6-dichlorobenzimidazole riboside (DRB; 75 µM). Concurrently, cortisol (0.01~1 µM) decreased rather than increased proinflammatory cytokine mRNA levels, including interleukin 1 beta (IL1B), interleukin 6 (IL6), and tumor necrosis factor alpha (TNF), in a dose-dependent manner in human amnion fibroblasts. Chromatin immunoprecipitation assay revealed that glucocorticoid receptor was bound to PLA2G4A promoter in human amnion fibroblasts upon cortisol stimulation. This was confirmed by electrophoretic mobility shift assay showing that nuclear protein extracted from human amnion fibroblasts upon cortisol stimulation could bind the synthesized oligonucleotide sequence corresponding to PLA2G4A promoter region from –95 bp to –65 bp bearing the putative glucocorticoid response element. This binding was super shifted by glucocorticoid receptor antibody. In conclusion, we demonstrated in this study that cortisol increased PLA2G4A mRNA level via GR-dependent ongoing transcription in human amnion fibroblasts by activating the binding of GR to PLA2G4A promoter directly, and this effect appeared unlikely to be secondary to the effect of cortisol on the expression of proinflammatory cytokines in human amnion fibroblasts.

amnion, cortisol, glucocorticoid receptor, parturition, PLA2G4A, placenta, pregnancy, prostaglandin

INTRODUCTION

Glucocorticoids (GCs) are widely accepted as anti-inflammatory drugs [1, 2], largely because GCs inhibit the production of proinflammatory cytokines and prostaglandins (PGs) [36]. Prostaglandins are formed via the action of multiple enzymes in the arachidonic acid cascade [7], with cytosolic phospholipase A2 group IVA (PLA2G4A) and prostaglandin-endoperoxide synthase 2 (PTGS2) being the two enzymes catalyzing the rate-limiting steps for the synthesis of PG [79]. Cytosolic PLA2 group IVA is responsible for the liberation of arachidonic acid, the rate-limiting substrate, from membrane phospholipids [8], whereas PTGS2 catalyzes the subsequent formation of prostaglandin H2 (PGH2) from arachidonic acid, the rate-limiting step in PG synthesis [9]. Glucocorticoids are well known to inhibit proinflammatory cytokine-induced PLA2G4A and PTGS2 expression at the site of inflammation either via downregulation of proinflammatory cytokine expression or by inhibiting the pathways used by the proinflammatory cytokines in the induction of the PG synthesizing enzyme expression [1013].

Human fetal membranes are the predominant source of PGs in pregnancy, synthesizing increasing amounts of PG with advancing gestational age [7, 14]. Accumulating evidence strongly suggests that activation of PG synthesis in the fetal membranes is one of the ultimate pathways leading to parturition both at term and preterm in humans [7, 15]. Paradoxically, there are equally massive increases in plasma levels of both cortisol and PGs during parturition [16]. This phenomenon has been claimed to be attributed to stimulation of PLA2G4A and PTGS2 expression by GCs, particularly in amnion fibroblasts, which are the major cell type producing PGs in the fetal membranes [1720]. However, the mechanisms of these effects of GCs on PLA2G4A and PTGS2 expression in human amnion fibroblasts are not very well understood. Analysis of the cloned sequence of the human PLA2G4A gene promoter revealed potential glucocorticoid response elements (GREs) flanking the PLA2G4A gene [21]. However, we do not know whether glucocorticoid receptor (GR) activated by GCs may directly bind the PLA2G4A promoter region, thereby upregulating PLA2G4A mRNA transcription in human amnion fibroblasts.

In this study, we examined whether cortisol may regulate PLA2G4A gene expression at the transcription level via the interaction between GR and the putative GRE in the PLA2G4A promoter in human amnion fibroblasts.

MATERIALS AND METHODS

Human Amnion Fibroblast Preparation and Treatments

Human fetal membranes were collected from patients undergoing elective cesarean delivery at term after we received informed consent from all patients according to the guidelines set forth in a protocol that is in compliance with the Institutional Review Board of Fudan University. Amnion was peeled off chorion and washed thoroughly in cold PBS (pH 7.5) to get rid of the residual blood. Amnion then was digested with 0.125% trypsin (Sigma, St. Louis, MO) and 0.02% DNase (Sigma) twice for 30 min at 37°C. The digestion media were discarded, and the remaining amnion tissue was washed vigorously with PBS to get rid of residual epithelial cells. The remaining tissue then was subjected to digestion with 0.1% collagenase (Roche, Indianapolis, IN) at 37°C for 1 h. The digestion medium was collected and centrifuged at 2300 rpm. Cell pellets were resuspended in Dulbecco modified Eagle medium (DMEM; Sigma) and loaded onto a discontinuous Percoll (Amersham Biosciences, Uppsala, Sweden) gradient column (5%, 20%, 40%, and 60%). The gradient column was centrifuged at 2500 rpm, and a single band of cells around 20% Percoll concentration was collected. Cells were plated at a density of 1.5 x 106 cells per well in a six-well plate in DMEM without Phenol red containing 10% fetal calf serum (FCS) and antibiotic-antimycotic. The identity of cells prepared as described above has been previously verified, and more than 90% of the cells are fibroblasts [20]. The amnion fibroblasts were cultured for 2–3 days at 37°C and 5% CO2 in air before the start of treatment.

On the day of treatment, the medium was changed to FCS-free medium, and the cells were then treated with cortisol (0.01, 0.1, and 1 µM) for 24 h with and without the GR antagonist RU486 (1 µM). In another set of experiments, the cells were treated with the mRNA transcription inhibitor 5,6-dichlorobenzimidazole riboside (DRB; 75 µM; Sigma) 1 h prior to cortisol treatment, and then DRB treatment was continued with cortisol treatment for another 24 h. At the ends of the above time periods, cells were collected for total RNA extraction using RNeasy kit (Qiagen, Valencia, CA). RNA (1.0 µg) was reverse transcribed with oligo(dT)17 primers using a Superscript II kit (Life Technologies Inc., Grand Island, NY) for subsequent measurement of PLA2G4A, interleukin 1 beta (IL1B), IL6, and tumor necrosis factor alpha (TNF) mRNA levels with real-time PCR.

Measurements of PLA2G4A and Proinflammatory Cytokine mRNA Levels in Amnion Fibroblasts upon Cortisol Treatment with Real-Time PCR

To measure PLA2G4A, IL1B, IL6, and TNF mRNA levels, quantitative real-time PCR (qRT-PCR) analysis was performed with the primer sequences as listed in Table 1. To control sampling errors, qRT-PCR for the housekeeping gene beta actin was routinely performed on each sample. The reaction solution consisted of 2.0 µl diluted RT-PCR product, 0.2 µM of each paired primer, and power SYBR Green PCR master mix (Toyobo, Osaka, Japan). The annealing temperature was set at 61°C, and amplification cycles were set at 45 cycles. The absolute mRNA levels in each sample were calculated according to a standard curve set up using serial dilutions of known amounts of specific templates against corresponding cycle threshold (Ct) values. Then, the ratio of the target gene over beta actin in each sample was obtained to normalize the expression of the target gene. The specificity of the primers was verified by both gel electrophoresis and sequencing of the PCR products.


View this table:
[in this window]
[in a new window]
[Download PPT slide]
 
TABLE 1 Primer sequences (from 5' to 3') used in real-time PCR.

Chromatin Immunoprecipitation (ChIP) Assay Showing GR Binding to PLA2G4A Promoter in Human Amnion Fibroblasts

Primary human amnion fibroblasts were prepared as described above and plated in 10-cm Petri dishes at a density of 107 cells/dish. The cells were treated with cortisol (1 µM) for 12 h before ChIP assay using a kit from Upstate Biotechnology (Temecula, CA) and a method modified from the manufacturer's protocol. Upon termination of treatment, the cells were fixed with 1% formaldehyde to cross-link the transcription factors to chromatin DNA. After washing with PBS, the cells were incubated with glycine (125 mM) for 30 min and then scraped off the dish in cold PBS containing protease inhibitor cocktail. The cells were spun down at 720 x g at 4°C and resuspended with ice-cold lysis buffer supplemented with protease inhibitor cocktail and incubated on ice for 30 min. The cells then were gently broken up on ice using a Dounce homogenizer to aid nuclei release. The nuclei were spun down at 2400 x g at 4°C and were resuspended in digestion buffer supplemented with protease inhibitor cocktail. Enzymatic shearing of the chromatin DNA then was carried out at 37°C. The shearing time was optimized according to the pilot study to produce an optimized size of input DNA around 500 bp. The shearing was stopped by adding ice-cold EDTA, and the sheared DNA was centrifuged at 12 000 rpm at 4°C. The supernatant containing sheared DNA was collected for subsequent immunoprecipitation. The diluted sheared DNA was incubated at shaking with glucocorticoid receptor antibody (Santa Cruz Biotechnology, CA) or normal serum as negative control for 12 h at 4°C. Protein A agarose/salmon sperm DNA then was added to the above solution and incubated for 2 h at 4°C. The antibody/protein/DNA/agarose complex then was spun down at 8000 rpm and resuspended in low-salt buffer and allowed to pass through a 0.45-µm filter column. The column was washed repeatedly with low- and high-salt buffers, LiCl, and Tris EDTA (TE) buffer in order to minimize the nonspecific background. After washing, the filter column was eluted with elution buffer (1% SDS, 0.1 M NaHCO3), and the flow through was collected for subsequent reverse cross-linking with 5 M NaCl at 65°C for 4 h. At the end of reverse cross-linking, 0.5 M EDTA, 1 M Tris-HCl (pH 6.5), and proteinase K were added and incubated for 1 h at 45°C. The sheared DNA recovered from reverse cross-linking was extracted with DNA extraction kit for further PCR analysis.

Polymerase chain reaction primers for amplifying DNA fragments immunoprecipitated by GR antibody were designed according to the analysis with Transcription Element Search System (TESS). PCR was performed around 23 cycles, and PCR product of an expected size of 167 bp was analyzed with 2% agarose gel electrophoresis.

Electrophoretic Mobility Shift Assay

To further confirm the putative GRE in the PLA2G4A promoter, electrophoretic mobility shift assay (EMSA) was performed using biotin end-labeled double-stranded oligonucleotides designed according to the analysis with TESS and ChIP assay. The sense oligonucleotide sequence is 5'GAAGAGAGCGTTCTCCCTCTTCCCCTTTAA3', which corresponds to the promoter region from –95 bp to –65 bp spanning the predicted GRE. Nuclear protein was extracted from cultured human amnion fibroblasts stimulated with or without cortisol (1 µM) for 12 h using an extraction kit from Active Motif (Carlsbad, CA). The binding reaction of nuclear protein- and biotin-labeled oligonucleotides was carried out overnight at 4°C in the presence of binding buffer (10 mM Tris, 50 mM KCl, pH 7.5), poly(dI.dC) with or without 200-fold molar excess of unlabeled specific competitor sequences, and GR antibody (Santa Cruz Biotechnology, CA). The binding solution was then electrophoresed in a 6% polyacrylamide gel in 0.5x Tris-Borate-EDTA (TBE) at 100 V and transferred to a nylon membrane using a semidry transfer unit at 380 mA for 30 min. The transferred DNA was cross-linked to the membrane under ultraviolet light. The biotin-labeled DNA on the membrane was detected using a LightShift Chemiluminescent EMSA kit (Pierce Biotechnology, Rockford, IL) according to a protocol provided by the manufacturer. Briefly, after blocking, the membrane was incubated with streptavidin-horseradish peroxidase conjugate/blocking buffer. The membrane was then washed and incubated in substrate equilibration buffer. After discarding the substrate equilibration buffer, the membrane was incubated with substrate (luminol/enhancer/stable peroxide solution) for streptavidin-horseradish peroxidase for 1 min and, finally, the membrane was exposed to X-ray film.

All data are reported as mean ± SEM. Paired Student t-test or two-way ANOVA followed by the Student-Newman-Keuls test was used where applicable to assess significant differences between groups. Significance was set at P < 0.05. The values for n refer to the number of experiments performed with different preparations of primary cells from different patients.

RESULTS

Effect of Cortisol on PLA2G4A and Proinflammatory Cytokine mRNA Levels in Human Amnion Fibroblasts

Treatment of human amnion fibroblasts with cortisol (0.01, 0.1, and 1 µM) for 24 h caused dose-dependent increases in PLA2G4A mRNA levels (Fig. 1A). The GR antagonist RU486 (1 µM) was able to block the increase of PLA2G4A mRNA levels in amnion fibroblasts (Fig. 1B). Treatment with the mRNA transcription inhibitor, DRB (75 µM), completely blocked the induction of PLA2G4A mRNA expression by cortisol (1 µM) in amnion fibroblasts (Fig. 1C). These results suggest that the upregulation of PLA2G4A mRNA level by cortisol was dependent on GR activation and ongoing transcription. Cortisol (0.01, 0.1, and 1 µM) treatment also caused concurrent significant dose-dependent decreases in IL1B, IL6, and TNF mRNA levels along with the increase in PLA2G4A mRNA level in amnion fibroblasts (Fig. 2), suggesting that the induction of PLA2G4A mRNA expression by cortisol was unlikely to be correlated to the proinflammatory cytokine levels in human amnion fibroblasts, as proinflammatory cytokines are known to induce rather than to inhibit the expression of prostaglandin-synthesizing enzymes [1013].


Figure 01
View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIG. 1 A) Concentration-dependent effect of cortisol on PLA2G4A mRNA levels in human amnion fibroblasts (n = 7). *P < 0.05, **P < 0.01 versus no-cortisol treatment control group. B) Inhibitory effect of glucocorticoid receptor antagonist RU486 (RU; 1 µM) on cortisol (1 µM)-induced changes of PLA2G4A mRNA levels in human amnion fibroblasts (n = 7). **P < 0.01 versus control group (ctr), ##P < 0.01 versus cortisol group (F). C) Effect of DRB (75 µM), the mRNA transcription inhibitor, on cortisol (1 µM)-induced changes of PLA2G4A mRNA levels in human amnion fibroblasts (n = 4). **P < 0.01 versus control group (ctr); #P < 0.05 versus cortisol group (F) without DRB treatment. Error bars indicate mean ± SEM.


Figure 02
View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIG. 2 Concentration-dependent effect of cortisol on TNF (n = 5), IL1B (n = 6), and IL6 (n = 5) mRNA levels in human amnion fibroblasts. *P < 0.05; **P < 0.01 versus no-cortisol treatment control group. Error bars indicate mean ± SEM.

Binding of GR to PLA2G4A Promoter upon Cortisol Stimulation in Human Amnion Fibroblasts

Chromatin immunoprecipitation assay showed that treatment of human amnion fibroblasts with cortisol (1 µM) for 12 h caused association of GR with the PLA2G4A promoter, as reflected by the abundance of PCR product amplified using primers spanning the promoter region at –89 bp~+78 bp with sheared DNA precipitated by GR antibody as template (Fig. 3). There was little PCR product formed without cortisol stimulation or with cortisol stimulation but without specific GR antibody precipitation when the PCR reaction was stopped at 23 cycles (Fig. 3). There was no obvious binding of GR with the PLA2G4A promoter region upstream to –89 bp, as demonstrated using primers spanning the promoter region upstream to –89 bp (data not shown).


Figure 03
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIG. 3 Representative ChIP showing GR bound to PLA2G4A promoter in human amnion fibroblasts upon cortisol (1 µM; F) stimulation for 12 h. Top panel illustrates the positions and sequences of primers used in PCR amplifying the DNA fragment immunoprecipitated by GR antibody. Bottom panel shows the PCR products electrophoresed in 2% agarose gel. F + Ab, with cortisol treatment and GR antibody precipitation; ctr + Ab, without cortisol treatment and with GR antibody precipitation; F-Ab, with cortisol treatment and without GR antibody precipitation.

Electrophoretic mobility shift assay revealed that nuclear protein extracted from human amnion fibroblasts stimulated by cortisol for 12 h could bind the synthesized oligonucleotide sequence of PLA2G4A promoter from –95 bp to –65 bp (5'GAAGAGAGCGTTCTCCCTCTTCCCCTTTAA3'), which spanned the predicted GRE, as revealed by ChIP assay and TESS analysis. The binding of nuclear protein to this oligonucleotide sequence produced four distinguishable shifted bands upon gel electrophoresis (Fig. 4). Incubation with GR antibody super shifted two of the four bands (Fig. 4), suggesting there might be two DNA-protein complexes bound by GR. Although the nuclear extract from amnion fibroblasts without cortisol treatment could also shift the bands, the density of the bands super shifted by GR antibody was lower than that with cortisol treatment. The average intensity of supershifted bands in the cortisol-treated group was 137.6% ± 8. 3% (n = 4) of the control group. Excessive nonlabeled specific oligonucleotides diminished both shifted and super shifted bands by nuclear extract and GR antibody (Fig. 4), indicating that the binding of nuclear protein with the oligonucleotides was specific.


Figure 04
View larger version (77K):
[in this window]
[in a new window]
[Download PPT slide]
 
FIG. 4 Representative EMSA showing nuclear protein extract from human amnion fibroblasts caused shifts of the PLA2G4A promoter oligonuleotides bearing putative GRE and GR antibody caused super shifts of the oligonucleotides bound with nuclear protein. Lane 1, no nuclear protein; lane 2, with nuclear protein extracted from amnion fibroblasts without cortisol treatment and without GR antibody immunoprecipitation; lane 3, with nuclear protein extracted from amnion fibroblasts without cortisol treatment and with GR antibody immunoprecipitation; lane 4: with nuclear protein extracted from amnion fibroblasts with cortisol treatment and without GR antibody immunoprecipitation; lane 5, with nuclear protein extracted from amnion fibroblasts with cortisol treatment and with GR antibody immunoprecipitation; lane 6, with nuclear protein extracted from amnion fibroblasts with cortisol treatment, and with GR antibody immunoprecipitation, and with excess of unlabeled oligonucleotides.

DISCUSSION

In this study, we have demonstrated that cortisol has paradoxical stimulating effects on PLA2G4A mRNA levels in primary human amnion fibroblasts, which could be blocked by GR antagonist RU486 and by the messenger RNA transcription inhibitor DRB, suggesting that the increase of PLA2G4A mRNA level by cortisol is dependent on ongoing transcription mediated by GR in human amnion fibroblasts.

GCs have long been known to be effective anti-inflammatory drugs with potent inhibition of prostaglandin synthesis [1, 6]. As PLA2G4A catalyzes the release of arachidonic acid, the rate-limiting substrate for the synthesis of prostaglandins, from the membrane phospholipids [8, 22], great attention has been directed to the regulation of its expression and activity by GCs. Classically, GCs exerted powerful inhibition of proinflammatory cytokine-induced PLA2G4A expression in various tissues and cells [10, 2325]. In addition, GCs per se have also been shown to inhibit PLA2G4A activity [26, 27]. Furthermore, Xue et al. [28] found that dexamethasone alone also was able to lower PLA2G4A mRNA levels in WISH cells.

There is accumulating evidence in the literature showing that the induction of PLA2G4A and PTGS2 expression in human amnion fibroblasts is responsible for the increase in PGE2 production, in spite of a marked increase in cortisol levels at the end of pregnancy [1620]. These "paradoxical" effects of GCs are believed to be part of the feed forward loops triggering parturition [7, 15, 29]. However, the molecular mechanisms underlying these effects of cortisol remain unresolved. Gibb et al. [30] found that GCs inhibited PGE2 release from freshly prepared amnion fibroblasts but increased PGE2 release from amnion fibroblasts maintained in culture for a few days. They argued that freshly prepared cells had high proinflammatory cytokine levels, and thus GC treatment decreased PGE2 production via blocking the induction of proinflammatory cytokines, whereas cells maintained for a few days in culture had low levels of proinflammatory cytokines, and GC treatment thus led to increased PGE2 production. In spite of this, there was still no clue how GCs increase PLA2G4A and PTGS2 expression in amnion fibroblasts. This study demonstrated that amnion fibroblasts expressed high levels of proinflammatory cytokines and that cortisol increased PLA2G4A mRNA levels despite concurrent potent inhibition of proinflammatory cytokine expression. In addition, this study also demonstrated that IL1B treament did not affect the induction of PLA2G4A mRNA expression by cortisol in human amnion fibroblasts. All these observations suggest that GCs simulate PLA2G4A expression, regardless of the level of proinflammatory cytokines in human amnion fibroblasts.

In our previous study, we provided evidence for cortisol upregulation of PLA2G4A mRNA expression via stimulation of PLA2G4A promoter activity in primary human amnion fibroblasts [31]. In this study, we provided direct evidence showing GR binding to PLA2G4A promoter in primary human amnion cells upon cortisol stimulation using ChIP assay and EMSA. Furthermore, addition of GR antagonist RU486 could attenuate the induction of promoter activity by cortisol. All these findings lead us to propose that GCs stimulate PLA2G4A promoter activity via GR binding to GRE in the promoter in human amnion fibroblasts, which supports the earlier observation by Potestio et al. showing that the stimulatory effect of glucocorticoids on prostaglandin output was receptor mediated [19].

In conclusion, we have demonstrated in this study that cortisol upregulated PLA2G4A mRNA expression by activating GR binding to PLA2G4A gene promoter in human amnion fibroblasts.

FOOTNOTES

1Supported by the National Natural Science Foundation of China (30470655 and 30570680), the Ministry of Education of China (20050246015), and National Institutes of Health RO1 HD31514-10. Back

Correspondence: 2Kang Sun, School of Life Sciences, Fudan University, 220 Handan Rd., Shanghai 200433, China. FAX: 86 21 65490496; e-mail: sunkang2000{at}yahoo.com

Received: 5 July 2007.

First decision: 15 August 2007.

Accepted: 13 September 2007.

REFERENCES

  1. Rhen T and Cidlowski JA. Antiinflammatory action of glucocorticoids—new mechanisms for old drugs N Engl J Med 2005 35317117–17123
  2. Adcock IM and Caramori G. Cross-talk between pro-inflammatory transcription factors and glucocorticoids Immunol Cell Biol 2001 79376–384[CrossRef][Medline]
  3. Swantek JL, Cobb MH, Geppert TD. Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK) is required for lipopolysaccharide stimulation of tumor necrosis factor alpha (TNF-alpha) translation: glucocorticoids inhibit TNF-alpha translation by blocking JNK/SAPK Mol Cell Biol 1997 176274–6282[Abstract]
  4. Amano Y, Lee SW, Allison AC. Inhibition by glucocorticoids of the formation of interleukin-1 alpha, interleukin-1 beta, and interleukin-6: mediation by decreased mRNA stability Mol Pharmacol 1993 43176–182[Abstract]
  5. Tobler A, Meier R, Seitz M, Dewald B, Baggiolini M, Fey MF. Glucocorticoids downregulate gene expression of GM-CSF, NAP-1/IL-8, and IL-6, but not of M-CSF in human fibroblasts Blood 1992 7945–51[Abstract/Free Full Text]
  6. Newton R, Seybold J, Kuitert LM, Bergmann M, Barnes PJ. Repression of cyclooxygenase-2 and prostaglandin E2 release by dexamethasone occurs by transcriptional and post-transcriptional mechanisms involving loss of polyadenylated mRNA J Biol Chem 1998 27332312–32321[Abstract/Free Full Text]
  7. Challis JR, Sloboda DM, Alfaidy N, Lye SJ, Gibb W, Patel FA, Whittle WL, Newnham JP. Prostaglandins and mechanisms of preterm birth Reproduction 2002 1241–17[Abstract]
  8. Irvine RF. How is the level of free arachidonic acid controlled in mammalian cells? Biochem J 1982 2043–16[Medline]
  9. Kniss DA. Cyclooxygenases in reproductive medicine and biology J Soc Gynecol Investig 1999 6285–292[Medline]
  10. Newton R, Kuitert LM, Slater DM, Adcock IM, Barnes PJ. Cytokine induction of cytosolic phospholipase A2 and cyclooxygenase-2 mRNA is suppressed by glucocorticoids in human epithelial cells Life Sci 1997 6067–78[CrossRef][Medline]
  11. Newton R. Molecular mechanisms of glucocorticoid action: what is important? Thorax 2000 55603–613[Free Full Text]
  12. Didonato JA, Saatcioglu F, Karin M. Molecular mechanisms of immunosuppression and anti-inflammatory activities by glucocorticoids Am J Respir Crit Care Med 1996 154(Pt 2)S11–S15[Medline]
  13. Auphan N, DiDonato JA, Rosette C, Helmberg A, Karin M. Immunosuppression by glucocorticoids: inhibition of NF-kappa B activity through induction of I kappa B synthesis Science 1995 270286–290[Abstract/Free Full Text]
  14. Duchesne MJ, Thaler-Dao H, de Paulet AC. Prostaglandin synthesis in human placenta and fetal membranes Prostaglandins 1978 1519–42[CrossRef][Medline]
  15. Challis JRG, Matthews SG, Gibb W, Lye SJ. Endocrine and paracrine regulation of birth at term and preterm Endocr Rev 2000 21514–550[Abstract/Free Full Text]
  16. Casey ML, MacDonald PC, Mitchell MD. Despite a massive increase in cortisol secretion in women during parturition, there is an equally massive increase in prostaglandin synthesis. A paradox? J Clin Invest 1985 751852–1857[Medline]
  17. Economopoulos P, Sun M, Purgina B, Gibb W. Glucocorticoids stimulate prostaglandin H synthase type-2 (PGHS-2) in the fibroblast cells in human amnion cultures Mol Cell Endocrinol 1996 117141–147[CrossRef][Medline]
  18. Blumenstein M, Hansen WR, Deval D, Mitchell MD. Differential regulation in human amnion epithelial and fibroblast cells of prostaglandin E(2) production and prostaglandin H synthase-2 mRNA expression by dexamethasone but not tumour necrosis factor-alpha Placenta 2000 21210–217[CrossRef][Medline]
  19. Potestio FA, Zakar T, Olson DM. Glucocorticoids stimulate prostaglandin synthesis in human amnion cells by a receptor-mediated mechanism J Clin Endocrinol Metab 1988 671205–1210[Abstract]
  20. Sun K, Ma R, Cui X, Campos B, Webster R, Brockman D, Myatt L. Glucocorticoids induce cytosolic phospholipase A2 and prostaglandin H synthase type 2 but not microsomal prostaglandin E synthase (PGES) and cytosolic PGES expression in cultured primary human amnion cells J Clin Endocrinol Metab 2003 885564–5571[Abstract/Free Full Text]
  21. Wu T, Ikezono T, Angus CW, Shelhamer JH. Characterization of the promoter for the human 85 kDa cytosolic phospholipase A2 gene Nucleic Acids Res 1994 225093–5098[Abstract/Free Full Text]
  22. Lappas M and Rice GE. Phospholipase A2 isozymes in pregnancy and parturition Prostaglandins Leukot Essent Fatty Acids 2004 7087–100[CrossRef][Medline]
  23. Hoeck WG, Ramesha CS, Chang DJ, Fan N, Heller RA. Cytoplasmic phospholipase A2 activity and gene expression are stimulated by tumor necrosis factor: dexamethasone blocks the induced synthesis Proc Natl Acad Sci U S A 1993 904475–4479[Abstract/Free Full Text]
  24. Dolan-O'Keefe M, Chow V, Monnier J, Visner GA, Nick HS. Transcriptional regulation and structural organization of the human cytosolic phospholipase A2 gene Am J Physiol Lung Cell Mol Physiol 2000 278L649–L657[Abstract/Free Full Text]
  25. Schalkwijk CG, Vervoordeldonk M, Pfeilschifter J, van den Bosch H. Interleukin-1 beta-induced cytosolic phospholipase A2 activity and protein synthesis is blocked by dexamethasone in rat mesangial cells FEBS Lett 1993 333339–343[CrossRef][Medline]
  26. Yao XL, Cowan MJ, Gladwin MT, Lawrence MM, Angus CW, Shelhamer JH. Dexamethasone alters arachidonate release from human epithelial cells by induction of p11 protein synthesis and inhibition of phospholipase A2 activity J Biol Chem 1999 27417202–17208[Abstract/Free Full Text]
  27. Kol S, Ben-Shlomo I, Payne DW, Ando M, Rohan RM, Adashi EY. Glucocorticoids suppress basal (but not interleukin-1-supported) ovarian phospholipase A2 activity: evidence for glucocorticoid receptor-mediated regulation Mol Cell Endocrinol 1998 137117–125[CrossRef][Medline]
  28. Xue S, Slater DM, Bennett PR, Myatt L. Induction of both cytosolic phospholipase A2 and prostaglandin H synthase-2 by interleukin-1 beta in WISH cells in inhibited by dexamethasone Prostaglandins 1996 51107–124[Medline]
  29. Whittle WL, Patel FA, Alfaidy N, Holloway AC, Fraser M, Gyomorey S, Lye SJ, Gibb W, Challis JR. Glucocorticoid regulation of human and ovine parturition: the relationship between fetal hypothalamic-pituitary-adrenal axis activation and intrauterine prostaglandin production Biol Reprod 2001 641019–1032[Abstract/Free Full Text]
  30. Gibb W and Lavoie JC. Effects of glucocorticoids on prostaglandin formation by human amnion Can J Physiol Pharmacol 1990 68671–676[Medline]
  31. Sun K, Qu X, Gao L, Myatt L. Dexamethasone fails to inhibit the induction of cytosolic phospholipase A2 expression by interleukin-1beta in cultured primary human amnion fibroblasts Placenta 2006 27164–170[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
78/1/193    most recent
biolreprod.107.063990v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, C.
Right arrow Articles by Sun, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, C.
Right arrow Articles by Sun, K.
Agricola
Right arrow Articles by Guo, C.
Right arrow Articles by Sun, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS