|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The Jackson Laboratory, Bar Harbor, Maine 04609
ABSTRACT
Several secreted products of the TGFbeta superfamily have important roles during follicular development and are produced by both oocytes and somatic cells (granulosa and theca) in the follicle. The proprotein convertases are a family of seven known proteins that process TGFbeta ligands and other secreted products to their mature active form. The present study examined the regulation of steady-state levels of Pcsk6 mRNA, which encodes a convertase protein known to process members of the TGFbeta superfamily, during mouse follicular development. Pcsk6 mRNA and protein were expressed in preantral but not cumulus or mural granulosa cells. Pcsk6 mRNA levels in preantral granulosa cells were not regulated by growing oocytes of preantral follicles, but were elevated by FSH. Furthermore, Pcsk6 mRNA in preantral granulosa cells was potently suppressed by factor(s) secreted by fully grown oocytes from antral follicles, in part through SMAD2/3-mediated pathways. Oocytes acquired the ability to suppress the steady-state levels of Pcsk6 mRNA in granulosa cells during the preantral to antral follicle transition. Suppression of Pcsk6 mRNA by oocytes could reflect a change in the mechanism(s) regulating the activity of members of the TGFbeta superfamily.
cumulus cells, convertase, follicle, follicular development, gamete biology, granulosa, granulosa cells, oocyte, oocyte development
Ovarian follicular growth and development is dependent on both locally produced hormones and growth factors and gonadotropins from the pituitary. Intercommunication between the granulosa cells and the oocyte is a crucial aspect of the local control of follicle growth [1]. Oocytes stimulate glycolysis [2], proliferation [3, 4], amino acid transport [5], and survival [6] of companion granulosa cells. These effects of oocytes are mediated, in part, through production of secreted factors of the TGFβ superfamily of proteins [7–10]. The granulosa cells also regulate oocytes and their own growth and development through the production of intraovarian factors, which include activins, inhibin, AHM, KITL, and BMPs [7, 8, 11–16]. Thus, autocrine and paracrine signals from oocytes and granulosa cells are important for follicular development.
Many of the intraovarian regulators of folliclular and oocyte development belong to the TGFβ superfamily of proteins. These include activin, AMH, various BMPs, GDF9, and TGFB [7–11]. Initially, these are produced as proproteins that must be cleaved by specific proteases to produce mature active forms. The proprotein convertases (PCs) are a family of proteins that mediate the processing of secreted, cell surface, and transmembrane proteins [17]. There are seven known convertase proteins that cleave at basic amino acid residues with a (K/R)-(X)n-(K/R) motif, where n = 0, 2, 4, or 6 residues [17]. This motif is present in the unprocessed form of TGFβ family proteins involved in follicular development, indicating that these products must be processed to achieve full biological activity [17]. Pcsk1 and Pcsk2 are mainly expressed in neuroendocrine tissues and pancreas [18, 19], whereas Pcsk4 is specific to the testes with slight staining of interstitial cells in the ovary [20, 21]. Conversely, Furin and the closely related Psck6, along with Pcsk5 and Psck7, are more widely expressed [22–26]. In preliminary studies, we found that in contrast to other convertase proteins, high expression of Pcsk6 in preantral follicles and low expression in antral follicles. Thus, Pcsk6 may play an important role during the preantral to antral follicle transition.
TGFβ proteins are processed by at least four of the convertase proteins (FURIN, PCSK5, PCSK6, and PCSK7) [24, 25, 27]. Given that convertase proteins are required for producing active forms of important TGFβ ligands present in the ovary, we sought to determine their spatial and temporal regulation during follicular development. The present study examined the regulation of Pcsk6, which is highly expressed in preantral granulosa cells but not in fully differentiated cumulus cells, during follicular development in the mouse, with special attention to regulation by oocytes and/or FSH.
Female B6SJLF1 mice were produced and raised in the research colony of the investigators at The Jackson Laboratory and were used for all experiments. Ovaries from unprimed 12, 14, 16, 18, and 20-day-old animals, from 20-day-old animals injected with 5 IU of eCG (48 h), or eCG-primed animals injected with hCG (8 h) were used for all experiments. The eCG and hCG were obtained from the National Hormone and Peptide Program, NIDDK. Animals were maintained according to the Guide for the Care and Use of Laboratory Animals (Institute for Learning and Animal Research).
Isolation of Oocytes, Cumulus-Oocyte Complexes (COCs), and Granulosa Cells
Cumulus-oocyte complexes (COCs) at the germinal vesicle (GV) stage were collected from antral follicles by gentle puncture with a syringe and needle. Oocytectomized cumulus complexes (OOX) were obtained by microsurgical extirpation of the oocyte from the COCs, as previously described [28]. Mural granulosa cells were collected from eCG-primed female mice after puncture of the follicle with a syringe and needle. Fully grown oocytes from eCG-primed female mice, and Day 16 and Day 18 oocytes from small and large antral follicles, respectively, were isolated by follicle puncture and gentle pipetting of the COCs. Preantral-oocyte complexes (POCs) and growing oocytes were collected from immature animals on Day 12 or 14 after birth using collagenase digestion as described previously [29–31]. Preantral granulosa cells were isolated by passing POCs through a small-bore glass pipette to separate granulosa cells from the mid-growth stage (growing) oocytes. Oocytes from preantral follicles (Days 12 and 14) were collected by collagenase digestion and gentle pipetting as described previously [29–31].
Culture of COCs and Granulosa Cells
COCs, POCs, and preantral granulosa cells (oocytectomized POCs) were cultured under oil for 15 h in 25-µl drops of bicarbonate-buffered MEM-
(Life Technologies, Inc., Grand Island, NY) with Earles salts, supplemented with 75 mg/L penicillin G, 50 mg/L streptomycin sulfate, 0.23 mM pyruvate, and 3 mg/ml crystallized lyophilized bovine serum albumen. Some cultures of POCs or preantral granulosa cells were cocultured with fully grown oocytes (2 oocytes/µl), Day 18 oocytes (2 oocytes/µl), Day 16 and Day 14 oocytes (3 oocytes/µl), or Day 12 oocytes (4 oocytes/µl) for 15 h. Different numbers of oocytes were used for the different ages to compensate for oocyte size differences [32]. In addition to oocyte coculture, some groups of POCs were treated with FSH (0.5 IU/ml). Some cultures of POCs were pre-incubated with SB431542 (5 µmol/L, Calbiochem) to block both SMAD2 and SMAD3 activation for 1 h before beginning treatment. SB431542 specifically inhibits the activity of ALK4, ALK5, and ALK7, which signal through SMAD2 and SMAD3, without effect on other cellular kinases [33, 34]. SB431542 is also without effect on levels of pSMAD1/5/8 or nonphosphorylated SMAD2 in cumulus cells [35]. In some experiments, POCs were cultured for 2–10 days on collagen membranes in bicarbonate-buffered Waymouth medium MB 752 (Sigma, St. Louis, MO) supplemented with 3 mg/ml BSA, 5 µg/ml insulin, 5 µg/ml transferrin, and 5 ng/ml selenium or medium containing FSH (0.005 IU/ml).
All cultures were maintained at 37°C in a modular incubation chamber (Billups Rothenberg, Del Mar, CA) in an atmosphere of 5% O2, 5% CO2, and 90% N2. Samples taken at various times were frozen in liquid nitrogen and stored at –70°C until analyzed for steady-state mRNA levels as described below. All reagents were purchased from Sigma Chemical Company (St. Louis, MO), unless otherwise noted.
A fragment of 803 bp from the Pcsk6 gene (EMBL accession number BC037450) was amplified by PCR using gene-specific primers: 5'-ATCCCCATAGTGCAGGTGCTAC-3' and 5'-CTTTCATCAGCATAAAGTCCGG-3'. The PCR product was cloned into pCRII–TOPO plasmid using the TOPO TA Cloning Kit (Invitrogen) and was sequenced to confirm its identity. Plasmid DNA was digested with XhoI (antisense) or SpeI (sense) and used for in vitro transcription to make [33P]-CTP-labeled riboprobes for in situ hybridization as reported previously [36].
Isolation of mRNA and Real-Time RT-PCR
Total RNA was isolated from frozen samples (25 COC, POC, or oocytectomized complexes) and reverse transcribed into cDNA as described previously [37]. Quantification of Pcsk6 mRNA in POC and isolated preantral granulosa cells was conducted using real-time PCR with gene-specific primers (Pcsk6-F, TCCTCGATGACGGCATAGAAA; Pcsk6-R, TTCTCGTTGCTGGCGTCATAT), as described previously [37]. Only one product, which was of the appropriate size, was identified and sequenced to confirm specificity of the PCR reaction. Levels of Rpl19 mRNA was used to normalize specific levels of Pcsk6 mRNA according to the formula 2-(Ct gene of interest - Ct Rpl19), where Ct is the cycle number at which point the fluorescent intensity for each sample crosses a threshold level set above background, as described previously [29, 37]. All experiments were repeated three or four times and values shown are the mean ± SEM.
Samples were prepared from 40 to 50 POCs or from ovaries from 12-day-old animals. Treatment groups are described in figure legends and in the Results section. Samples were simultaneously denatured by boiling in 1X loading buffer for 5 min, followed by quenching on ice for 5 min. Whole ovaries were homogenized in 1X loading buffer using an electric tissue homogenizer. Proteins were separated on a 10%–15% SDS PAGE gel and transferred to PVDF membrane. Membranes were blocked in 1X blocking buffer (Odyssey Blocking Buffer, Licor Bioscience, Lincoln, NE) for 1 h with shaking at room temperature followed by incubation with specific anti-pSMAD2 antibody (1:1000, Invitrogen), anti-PCSK6 (1:1000, Alexis Biochemicals), or β-actin (ACTB) antibody (1:6000, Sigma) diluted in blocking buffer with 0.1% Tween-20 for 2–12 h at room temperature. Following incubation, blots were subjected to three 10-min washes with wash buffer (PBS, 0.1% Tween-20). Fluorescently labeled secondary antibodies (IRDye 800 anti-mouse or anti-rabbit, Rockland Immunochemicals, Inc., Gilbertsville, PA) were diluted at 1:5000 and incubated with the blots for 1 h at room temperature. Blots were washed as above with an additional final wash in PBS without Tween-20. Detection was accomplished with an infrared scanner (Licor Bioscience).
Ovaries from 12-day-old mice, 20-day-old mice, and 20-day-old mice primed with eCG (44 h) followed by hCG (8 h) were fixed overnight in 4% parformaldehyde and embedded in paraffin wax. Ovarian sections were dewaxed in xylene (two 5-min washes) followed by incubation for 5 min in each of the following: xylene:ETOH (1:1), 100% ETOH (2X), 95% ETOH, 85% ETOH, 75% ETOH, and ddH2O. Slides were then incubated in 1X antigen retrieval solution (DakoCytomation Retrieval solution) at 95°C for 25 min, followed by two 10-min washes with ddH2O and three 5-min washes with PBS. Slides were then incubated in blocking buffer (PBS, pH 7.4, 3% BSA, 10% goat serum, and 0.05% Triton-X 100) for 1 h at room temperature followed by incubation with anti-PCSK6 (1:500, Alexis Biochemicals) diluted in blocking buffer for 12 h at 4°C. Slides were then subjected to three 15-min washes with wash buffer (PBS 0.1% Triton-X 100), followed by incubation with Goat anti-rabbit IgG Alexa-594 conjugate (1:1500, Molecular Probes) for 1 h at room temperature, after which they were counterstained with DAPI and mounted with anti-fade solution (Slow-fade, Molecular Probes). Slides were imaged using in an Olympus BX60 upright fluorescent microscope connected to a 3CCD camera and computer.
Results from mRNA expression experiments were analyzed by either two-way ANOVA within-treatment group followed by Tukeys HSD post-hoc test if a positive F-test was detected or by Student t-test as indicated in the figure legends. A P-value less than or equal to 0.05 was considered statistically significant. Microsoft Excel was used for Student t-test analysis and JMP 6.1 statistical analysis software was used for ANOVA analyses (SAS, Cary, NC).
Expression Pattern of Pcsk6 mRNA and Protein
In situ hybridization of ovarian tissue sections revealed that Pcsk6 mRNA was expressed by granulosa cells of small to medium preantral follicles regardless of age of the animal (Day 12 or 20) (Fig. 1, A-C), but not in antral follicles (Fig. 1C). The staining pattern of PCSK6 protein was very similar to that of the mRNA with high levels in preantral granulosa cells and lower staining in antral follicles (Fig 2, A, C-D). Specific-staining was determined by omiting primary antibody (Fig. 2B). Only one immunoreactive band of approximately 65 kDa was detected in whole ovary lysates from 12-day-old animals (Fig. 2E). This size protein probably represents an alternatively spliced isoform of PCSK6 [38, 39]. Levels of PCSK6 protein were not induced in preovulatory follicles of hCG-treated animals (Fig. 2D).
|
|
Regulation of Steady-State Pcsk6 mRNA Levels by Fully Grown, but Not Growing, Oocytes
Real-time PCR analysis revealed that POCs expressed much higher levels of Pcsk6 mRNA than either COCs or mural granulosa cells from antral follicles (Fig. 3A). The levels of some transcripts observed in granulosa cells are elevated by oocyte-derived paracrine factors (e.g., Slc38a3, Ldha, Pfkp, Amh, Ptgs2, Has2, Ptx3, and Tnfaip6) [1, 2, 5, 30, 35, 37, 40]. To determine whether growing oocytes from preantral follicles affect levels of Pcsk6, intact POCs or OOX POCs (preantral granulosa cells or PAGCs) were cultured for 15 h. Intact POCs expressed high levels of Pcsk6 but, surprisingly, OOX did not affect Pcsk6 mRNA levels, indicating that growing oocytes are not acutely (within 15 h) required for maintaining steady-state levels of this transcript (Fig. 3B). However, since COCs express much lower levels of Pcsk6 mRNA than POCs (Fig. 3A), the effect of coculture of POCs with fully grown oocytes from antral follicles was measured in an oocyte-granulosa cell stage-mismatch experiment. Fully grown oocytes potently suppressed levels of Pcsk6 mRNA in preantral granulosa cells to levels similar to those found in COCs (Fig. 3C).
|
Previous studies revealed that oocyte-derived paracrine factors affect the levels of various transcripts via SMAD2 phosphorylation [35]. To determine whether fully grown oocytes suppress Pcsk6 mRNA levels in preantral granulosa cells using SMAD2-mediated pathways, POCs were cultured in control medium, cocultured with fully grown oocytes, cultured in the presence of an inhibitor of SMAD2/3 activation (SB431542), or both fully grown oocytes and SB431542 for 15 h. Phosphorylation (activation) of SMAD2 was also measured in these samples. POCs cultured in control medium expressed high levels of Pcsk6 mRNA and relatively low levels of pSMAD2, but coculture with fully grown oocytes suppressed Pcsk6 mRNA levels (Fig. 4A) and was associated with an increase in pSMAD2 levels (Fig. 4B). SB431542 treatment alone had no effect on Pcsk6 mRNA, but partially blocked the suppressive effect of fully grown oocytes on Pcsk6 mRNA levels (Fig. 4A).
|
Effect of FSH on Pcsk6 mRNA Levels
FSH promotes the preantral to antral follicle transition [41, 42]. Therefore, the effect of FSH on Pcsk6 mRNA levels in granulosa cells was determined. FSH treatment increased Pcsk6 mRNA levels in POCs cultured for 15 h (Fig. 5A). However, FSH did not overcome the suppressive effect of fully grown oocytes on Pcsk6 mRNA levels (Fig. 5A). Next, the effect of FSH on Pcsk6 mRNA levels in isolated cumulus or mural granulosa cells was tested. FSH had a weak stimulatory effect on Pcsk6 mRNA levels in both mural and cumulus cells. This was suppressed by the fully grown oocytes, and this suppressive effect was antagonized by SB431542 (inhibiting SMAD2 phosphorylation) treatment (Fig. 5, B-C).
|
Suppression of Pcsk6 mRNA During Preantral to Antral Transition
POCs from 12-day-old pups can be cultured for periods up to about 10 days on collagen-coated membranes to allow development of COCs [4, 29, 43]. Since elevated Pcsk6 mRNA was found only in preantral granulosa cells, POCs were cultured on collagen-coated membranes to determine whether the in vivo pattern of expression is recapitulated in vitro, and to test the effect of low levels of FSH (0.005 IU/ml) on Pcsk6 mRNA levels during the period coincident with the preantral to antral transition [29, 37]. Levels of Pcsk6 mRNA were significantly decreased in granulosa cells by 6 days of culture regardless of whether FSH was present (Fig. 6A). To determine when oocytes acquire the ability to suppress levels of Pcsk6 mRNA, oocytectomized POCs from 12-day-old mice were cocultured with denuded oocytes collected from neonatal mice on Days 12 (4 oocytes/µl), 14 (3 oocytes/µl), 16 (3 oocytes/µl), and 18 (2 oocytes/µl); oocytes obtained from ovaries of mice of these ages correspond with oocytes taken from medium preantral, large preantral, early antral, and large antral follicles respectively. As shown in Figure 6B, as oocytes were isolated during the preantral to antral follicle transition in vivo, they progressively acquired competence to suppress the levels of Pcsk6 mRNA in preantral granulosa cells.
|
This study examined the regulation of Pcsk6 mRNA, which encodes a proprotein convertase present in the ovary, during the progression of follicular development in the mouse. Pcsk6 mRNA and protein were expressed robustly in granulosa cells of preantral follicles, but at much lower levels in cumulus cells and mural granulosa cells of antral follicles. Pcsk6 mRNA levels were not affected by growing oocytes from preantral follicles, but were potently suppressed by paracrine factor(s) secreted by fully grown oocytes from antral follicles. These factors act in part by stimulating SMAD2/3-mediated pathways in granulosa cells. Pcsk6 mRNA levels in granulosa cells were suppressed by oocytes as they developed during the preantral to antral follicle transition. FSH stimulated elevation of Pcsk6 mRNA levels in POCs, but did not block the ability of fully grown oocytes to suppress Pcsk6 mRNA levels. Granulosa cells lost the ability to respond to FSH by robustly increasing Pcsk6 mRNA once they differentiated to either cumulus or mural granulosa cells of antral follicles, suggesting that this aspect of the transition of preantral granulosa cells to cumulus/mural granulosa cells is irreversible.
FSH is essential for the development of large preantral and antral follicles, as deletion of Fshb or its receptor, Fshr, leads to follicular development arrested at the late preantral or early antral stages [41, 42]. FSH also stimulates levels of mural marker transcripts in mural granulosa cells [35, 40]. The effect of FSH on preantral granulosa cells is not well characterized. Results presented here show that preantral granulosa cells are clearly responsive to FSH for the elevation of Pcsk6 mRNA levels in vitro. However, levels of this transcript are much lower in antral follicles. That neither oocytectomy of COCs and/or stimulation with FSH elevate levels of Pcsk6 mRNA in cumulus cells (or mural cells) demonstrates that the capacity of these cell types to upregulate Pcsk6 is irrevocably altered during differentiation. Thus, low levels or Pcsk6 mRNA in mural and cumulus cells may be due to permanent alterations in the granulosa cells that render them incapable of responding to FSH by increased levels of Pcsk6 mRNA. In contrast, Lhcgr mRNA levels increase significantly in cumulus cells after removal of oocytes and stimulation with FSH [35, 40]. Thus, although some cumulus cells can change to express mural-like characteristics depending upon stimulation with FSH and/or oocyte-derived paracrine factors, cumulus cell differentiation from preantral granulosa cells appears irreversible.
Granulosa cells of various types express many transcripts in common. Preantral granulosa cells give rise to both cumulus and mural granulosa cells of antral follicles, but the preantral granulosa cells are more similar to cumulus cells than to mural granulosa cells. Both cumulus cells and preantral granulosa cells, but not mural cells, label strongly for a surface antigen (OA-1) [44], express anti-mullerian hormone (AMH) [45, 46], and the amino acid transporter SLC38A3 [5]. However, preantral granulosa cells are not functionally the same as cumulus cells since they are unable to undergo cumulus expansion, even when provided with appropriate stimuli [37]. Additional changes induced by oocytes occur in the preantral cells as they differentiate into cumulus cells [29, 37]. Several transcripts—such as Amh, Slc38a3, and Ar—are expressed more highly in cumulus cells, as compared to mural cells. These transcripts are also expressed at high levels in late preantral granulosa cells, and this level is sustained in cumulus cells, but not mural cells, by oocyte-secreted factors [5, 35, 46]. In contrast, levels of other transcripts, such as Ldha and Pfkp, encoding glycolytic enzymes, are promoted by oocytes only after antrum formation [2, 47].
Unlike transcripts that are expressed highly in cumulus cells and preantral granulosa cells, the expression pattern and regulation of Pcsk6 mRNA is unique in that it is highly expressed in preantral granulosa cells, but at barely detectable levels in cumulus cells or mural granulosa cells. Although this is the first transcript identified that displays this unique expression pattern, undoubtedly there are others, as preantral granulosa cells express many unique protein products, as examined by 2-D gel electrophoresis [48]. During differentiation of preantral granulosa cells into cumulus cells, oocyte-derived paracrine factors stimulate expression of transcripts important for cumulus cell function [29, 35, 37]. In the present study, oocytes progressively acquire the ability to suppress levels of Pcsk6 mRNA during the establishment of the cumulus cell phenotype. This occurs during both in vivo and in vitro differentiation of COCs and presents the first example of suppression of mRNA levels by oocytes during the preantral to antral follicle transition. In previous studies, the inhibitory effect of oocytes on mRNA levels were limited to suppression of mural marker transcripts, such as Lhcgr, Cyp11a1 and Cd34, which are induced by FSH in mural, but not cumulus cells [35, 40].
Oocytes drive differentiation of preantral granulosa cells to cumulus cells. Preantral granulosa cells differentiate into cumulus cells with the ability to undergo expansion in vitro, but only if cocultured with fully grown oocytes [29]. Moreover, oocytes promote the differentiation and maintenance of the cumulus cell phenotype, and prevent expression of the mural granulosa cell phenotype [2, 5, 29, 35, 36]. Thus, oocytes initiate a developmental program in preantral granulosa cells that leads to differentiation into cumulus cells during the preantral to antral follicle transition. Therefore, oocyte-derived paracrine factors could either specifically suppress Pcsk6 mRNA expression or initiate a general program driving the preantral granulosa cell to cumulus cell transition that includes downstream suppression of Pcsk6 transcript levels.
Fully grown oocytes suppress levels of mural transcripts via a pSMAD2/3-mediated mechanism [35, 40]. Likewise, in POCs, an inhibitor of SMAD2/3 activation partially blocks the ability of fully grown oocytes to suppress Pcsk6 mRNA levels. Thus, oocytes use similar SMAD2/3-dependent mechanisms to suppress both mural transcripts and preantral Pcsk6 transcripts in developing cumulus cells. However, pSMAD2 activation alone is insufficient to suppress Pcsk6 mRNA since the inhibitor of pSMAD2 activation (SB431542) does not fully block the oocyte's suppressive effect. Furthermore preantral follicles stain strongly for pSMAD2 [35, 40] and yet express high levels of Pcsk6 mRNA. Thus, suppression of Pcsk6 requires additional pathways to be activated by oocytes. Importantly, strong activation of pSMAD2 in preantral granulosa cells indicates that TGFβ ligands are present in preantral follicles and are likely processed by PCSK6.
The physiological implications of the decrease in Pcsk6 mRNA levels during the preantral to antral transition remain to be defined. The present study does not address the functional role of Pcsk6 in preantral granulosa cells or why this transcript should be downregulated in antral follicles. One clue to the function of Pcsk6 comes from animals with a deletion of the Pcsk6 gene, which leads to severe embryonic patterning defects and embryonic lethality in a high proportion of homozygous mutant embryos [24]. These defects resemble those found in Bmp4 mutant embryos [49], underscoring the importance of PCSK6 in processing BMP4 to its biologically active form. Some Pcsk6 mutant embryos survive and produce offspring, but it is unclear if their fertility is normal [24]. However, the experiments presented here identified Pcsk6 as a preantral granulosa cell-specific transcript that is stimulated by FSH, but progressively suppressed by oocyte-secreted factors during antrum formation. Differentiated granulosa cells are unable to upregulate Pcsk6 mRNA once suppressed. We may speculate on the functional role of Pcsk6 and the importance of its downregulation during antrum formation. One attractive possibility is that the cocktail of TGFβ ligands differs in preantral versus antral follicles as a consequence of Pcsk6 action. Similar ligands may be processed differently in a microenvironment containing PCSK6 versus one devoid of this protein, or some ligands may be processed more efficiently by PCSK6. In particular, two TGFβ superfamily members, GDF9 and AMH, exert their biological effect during the same developmental period when PCSK6 is most highly produced. Gdf9-null follicles arrest at the primary stage [50, 51], while Amh-null mice exhibit increased follicular activation [12, 52]. Both GDF9 and AMH are highly expressed in preantral follicles [12, 50–52] and may be targets of PCSK6. Another possibility is that PCSK6 is involved in the processing of ZP proteins during formation of the zona pellucida, which is produced by oocytes mostly during preantral follicular development [53]. Thus, Pcsk6 represents another granulosa cell transcript regulated by oocytes, but exhibiting a novel expression pattern during follicular development. Future studies will focus on potential targets of PCSK6 activity and on the activity and regulation of other convertase proteins present in the ovary.
ACKNOWLEDGMENTS
We thank Drs. Mary Ann Handel and Ann Dorward for their helpful suggestions in the preparation of this manuscript.
FOOTNOTES
1This work was supported by NIH HD23839. ![]()
Correspondence: 2John J. Eppig, The Jackson Laboratory, 600 Main Street, Bar Harbor, ME 04609. FAX: 207 288 6073; e-mail: john.eppig{at}jax.org
Received: 18 June 2007.
First decision: 15 July 2007.
Accepted: 28 September 2007.
REFERENCES
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |