| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
research-article |
Institutes of Reproductive Medicine4 and Biology,5 University of Münster, D-48129 Münster, Germany
ABSTRACT
Spermatozoa need to undergo regulatory volume decrease (RVD) upon ejaculation to counteract swelling due to the hypo-osmolality of female tract fluids. Defects in sperm RVD lead to failure in both cervical mucus penetration in humans and utero-tubal junction passage in mice. The role of K/Cl cotransporters (KCCs) in RVD was investigated by incubation of spermatozoa from the murine cauda epididymidis and from human ejaculates in media mimicking female tract fluid osmolalities in the presence of KCC inhibitors. Furosemide at 100 µM or more caused swelling of murine spermatozoa as detected with a flow cytometer by increased laser forward scatter over 30 to 75 min of incubation. Bumetanide, known to have low affinity for KCCs, was effective at 1 mM, whereas 10 µM and 20 µM of the specific inhibitor DIOA (dihydroindenyl-oxy alkanoic acid) increased cell volume. These drug doses were ineffective in human spermatozoa, which, however, responded to quinine, confirming the occurrence of RVD under control conditions. The molecular identity of the murine KCC isoform involved was determined at both mRNA and protein levels. Conventional RT-PCR indicated the presence of transcripts from Slc12a4 (KCC1), Slc12a6 (KCC3), and Slc12a7 (KCC4) in the testis, whereas RT-nested PCR revealed the latter two isoforms in sperm mRNA. Of these three isoforms, only SLC12A7 (KCC4) was detected in murine sperm protein by Western blotting. Therefore, besides organic osmolyte efflux and KCl release through separate K+ and Cl– ion channels, SLC12A7 also is involved in murine but not human sperm RVD mechanisms.
fertilization, gamete biology, sperm, sperm motility and transport
Cells exposed to hypotonic environments tend to swell as water moves through water channels in the plasma membrane to re-establish osmotic equilibrium. To prevent the detrimental effects of the subsequent decrease in cytoplasmic concentrations of important ions and enzymes, as well as distortion of the plasma membrane, which disturbs normal cellular functions, the cells undergo regulatory volume decrease (RVD) to retain their original size. This is effected by activation of channels and transporters that allow efflux of ions and organic osmolytes to reverse the inflow of water. The three mechanisms for inorganic ion transport in RVD include 1) parallel effluxes of K+ and Cl– through separate cation and anion channels, 2) nonelectrogenic K+/Cl– cotransport via the K/Cl cotransporter KCC, and 3) separate expulsion of K+ and Cl– by the two parallel K+/H+ and Cl–/HCO3– exchanges [1, 2]. The latter RVD mechanism is used by erythrocytes of some fish and the salamander, whereas KCC plays the key role in the RVD of mammalian erythrocytes [3]. Many nonerythrocytes also are known to undergo RVD using KCCs, such as human glioma cells [4] and corneal epithelial cells [5], rat pancreatic alpha cells [6], and newborn rat cardiomyocytes [7].
Upon ejaculation, spermatozoa stored in the distal epididymis, where the luminal fluid has an osmolality above that of serum, are expelled into the female tract, where fluid osmolalities are close to serum levels [8]. Seminal fluids that compose the vehicle for sperm transport also have serumlike osmolalities, which increase during and after liquefaction [9, 10]. This physiologic osmotic challenge to ejaculated sperm should invoke RVD, which has been shown to occur in the mouse [11], cynomolgus monkey [12], and human [13]. When sperm fail in RVD and swell to a certain extent, they change their flagellar shape [14] to avoid excessive stretching of the plasma membrane by coiling or angulation of the flagellum within the plasma membrane into a geometry that can accommodate a larger volume within the same surface area. Coiled or angulated spermatozoa in some domestic animals [8, 10] and in some transgenic mice [15] have been associated with infertility. In the boar and bull, there is also an association of sperm volume with fertility [16, 17]. In c-ros knockout mice, infertility is caused by the inability of the swollen angulated spermatozoa in the uterus to pass the utero-tubal junction into the oviduct [18]. In humans, swollen spermatozoa fail to penetrate and migrate through surrogate mucus [13]. Therefore, sperm RVD is a physiologic process that is important for fertilization in vivo.
Both K+ and Cl– channels, which enable separate effluxes of K+ and Cl– during RVD under physiologic conditions, have been identified in human and murine spermatozoa [19]. The present study investigated the involvement of KCCs in the physiologic process of RVD in murine and human spermatozoa using specific inhibitors, as well as their identification at the protein and mRNA levels. There are four types of isoforms, known as Slc12a4–7, which include two subgroups each for Slc12a4 (KCC1) and Slc12a6 (KCC3) [20]. Slc12a5 (KCC2) and Slc12a7 (KCC4) form a closely related subfamily, whereas Slc12a4 is more homologous to Slc12a6, with nucleotide sequences of the four isoforms sharing approximately 70% homology. Whereas SLC12A5 is only found in brain tissues and is insensitive to cell volume, SLC12A4, SLC12A6, and SLC12A7 have been implicated in the RVDs of some somatic cells, although they may also be involved in other cellular functions, such as K+ and Cl– homeostasis, cell growth, and apoptosis [3].
Test Substances and Incubation Media
All chemicals used were from Sigma-Aldrich (Tiefenbach, Germany), except where stated otherwise. All media used were based on BWW (Biggers, Whitten, and Whittingham) medium [21] modified to contain 20 mM Hepes in addition to NaHCO3 and 4 mg/ml BSA at pH 7.4. Osmolality was checked and adjusted if necessary by addition of deionized water or 1M NaCl to values mimicking the osmolalities of murine uterine fluid or human cervical mucus (330 or 290 mmol/kg, respectively) for the incubation of murine and human spermatozoa, respectively. Test substances were first made up as stock solutions: bumetanide (250 mM), furosemide (600 mM), dihydroindenyl-oxy alkanoic acid (DIOA; 50 mM), H74 (50 mM) in dimethyl sulfoxide (DMSO), and quinine (80 mM) in water. H74 is an analog of bumetanide produced by Höchst [22] and was generously provided by Dr. Herny Staines of Oxford University, U.K. The control medium for each experiment contained the equivalent highest concentration of DMSO present in the test media.
Murine Sperm Preparation and Incubation
All experiments used adult male C57BL/6N mice aged 70–150 days (Charles River, Sulzfeld, Germany). All experiments were conducted according to the German federal law on the care and use of laboratory animals (licence G67/2001).
Mice were killed by cervical dislocation after CO2 asphyxiation. The cauda epididymidis was dissected out, and the capsule was removed to expose the coiled tubule, which was carefully unraveled by gently tearing the connective tissue with fine jeweller's forceps. To provide spermatozoa in each incubation with a test substance or the control medium, a tubule segment of about 1 mm in length was excised and transferred to a 10-µl drop of test medium on a spatula. The tubule was gently compressed to release the sperm content and then was removed, and the spermatozoa were transferred to and dispersed in 200 µl test medium and incubated in 5% CO2 in air at 37°C up to 75 min. From each epididymis, six to eight incubations were prepared, including a basal control and a quinine treatment to provide a swelling response as a positive control and for comparison of the effects of other test substances. The order of the test media used was altered for each experiment to randomize any possible temporal and regional epididymal effects.
Preparation of Human Ejaculates for Sperm Recovery and Incubation
All ejaculates used in this study were obtained by masturbation from donors at the institute after abstinence of at least two days and were analyzed by routine procedures according to guidelines [23]. The use of semen samples for the investigation was approved by the ethics committee of the University of Münster medicine faculty and the Chamber of Physicians of Westfalen-Lippe, and by donors who provided written consent. The average spermiogram (mean [range]) of 13 healthy volunteers was: semen volume 3.1 ml (2–3.8 ml), sperm concentration 65 million/ml (26–142 million/ml), normal morphology 13% (8%–19%), motility (grades a + b + c) 63% (52%–89%), and liquefied semen osmolality of 333.7 mmol/kg (323–344 mmol/kg). After liquefaction, spermatozoa were washed through a Percoll gradient (40%:80%) with osmolality adjusted to that of each ejaculate, which was measured on 10-µl aliquots in a vapor pressure osmometer after a 2-min delay to ensure chamber saturation and accurate results (Wescor Vapro, Kreienbaum Messsystem, Langenfeld, Germany). Aliquots of washed sperm were incubated for 30 min at 37°C and 5% CO2 in air in media at osmolality mimicking cervical mucus (290 mmol/kg), with or without inhibitors.
Measurement of Cell Size by Flow Cytometry
Changes in sperm cell volume were measured by the method previously validated for murine [14] and human [24] spermatozoa. An aliquot of 40 µl sperm suspension was added to 200 µl of the same medium lacking BSA and containing 3 µl propidium iodide (PI; final concentration 6 µg/ml). Forward and side scatter signals from laser excitation at 488 nm were measured by a flow cytometer (Beckmann Coulter FC500; Krefeld, Germany) through a purpose-built 5° aperture for murine sperm and a normal 19° aperture for human spermatozoa. From 6000 to 10 000 events recorded in each sample after cell debris was excluded using forward and side scatter gating, nonviable sperm were gated out by the detection of PI fluorescence. Mean values of the forward scatter of viable sperm, which reflect cell volume, were analyzed, and the drug-treated sperm were compared to the control from the same epididymides or ejaculates.
Analysis of Sperm Proteins by Western Blotting
Murine sperm from the cauda epididymidis were collected by cannulation of the vas deferens and retrograde perfusion of the tubule lumen with a low-salt solution composed of 360 mM sucrose and 20 mM Tris (pH 7.0; containing 1 mM Na3VO4 as phosphatase inhibitor and a protease inhibitor cocktail), with osmolality of around 430 mmol/kg. After dispersion, the spermatozoa were washed three times by centrifugation at 600 x g for 5 min at 4°C, and 6 x 106 sperm aliquots were pelleted and were stored at –80°C. The washed sperm pellet was taken up in either a CHAPS buffer (10 mM CHAPS in 100 mM Tris buffer, pH 7.4) or another lysis buffer (125 mM NaCl, 25 mM Hepes, 10 mM EDTA, 10 mM Na-pyrophosphate, 10 mM NaF, 0.1% (w/v) SDS, 0.5% (w/v) deoxycholate, 1% (v/v) Triton X-100 at pH 7.3) containing protease inhibitor cocktail and 1 mM Na3VO4 for 1 h on ice, with frequent vortexing. The suspension was centrifuged for 20 min at 14 000 x g at 4°C, and the supernatant was stored frozen for protein analysis later. As positive controls for Western blotting, murine brain, kidney, and cardiac atrium were snap frozen, pulverized with a micro-dismembrator (Braun Biotech International, Melsungen, Germany), and extracted using the Triton/SDS buffer described above. Tissue extracts were estimated for protein concentrations using the modified Lowry protein assay (Bio-Rad Laboratories, München, Germany) and were stored at –80°C. Preliminary experiments indicated that denaturing proteins in the presence of ditiothreitol (DTT) at temperatures at or higher than 75°C led to degradation of KCC proteins. This confirmed the report by Su et al. [25] on the heat sensitivities of KCC proteins above 60°C. In subsequent experiments protein extracts were heated to 40°C for 10 min in the presence of DTT. Polyacrylamide gel electrophoretic separation of proteins was carried out using 4%–12% Bis-Tris precast gels (8 x 8 cm, 1 mm thick; NuPage; Invitrogen, CA) according to the manufacturer's instructions, with 40 µg protein or 6 million sperm extract in each lane. After electrophoresis, separated proteins were transferred to Hybond-ECL membranes at 150 mA for 2 h and were stained with Ponceau Red to check protein loading and to visualize the molecular weight markers. After blocking with StartingBlock (Pierce, Perbio Science, Bonn, Germany) for 1 h at room temperature, the blotted membrane was incubated with purified antibodies against SLC12A4, SLC12A6, and SLC12A7 (Alpha Diagnostics International, San Antonio, TX) at final dilutions of 1:7000 overnight at 4°C. After washing, the membrane was incubated with secondary antibodies (peroxidase-conjugated goat anti-rabbit IgG, Pierce; at 1:1000 dilution for 1 h). Peroxidase-bound protein bands were visualized using the ECL-Plus method (Femto-signal; Pierce). The molecular weights of the signal bands were analyzed using line densitometry software (ChemImage System, IS4400; Alpha Innotech Corp., San Laendro, CA).
Analysis of Testicular and Sperm mRNA by RT-PCR and Nucleotide Sequencing
For the study of mRNA, pieces of adult murine testis were snap frozen in liquid nitrogen and pulverized using the micro-dismembrator. Spermatozoa were collected by cannulation of the cauda epididymidis and were washed as described above for protein analysis using sterile PBS buffer made up in diethyl pyrocarbonate (DEPC) water and supplemented with NaCl to raise osmolality to 430 mmol/kg. Total RNA was extracted using the QIA shredder column and the RNeasy mini kit (Qiagen, Heidelberg, Germany) for spermatozoa and the RNeasy midi kit for testis tissue, with an extra step of DNase treatment for removal of DNA contamination. For RT-PCR, up to 2 µg of the extracted RNA was used for the synthesis of the first-strand cDNA using the SuperScript II reverse transcriptase (Invitrogen, Karlsruhe, Germany), according to the manufacturer's instructions. Another RNA aliquot was processed in parallel without the transcriptase as negative control for DNA contamination. To enhance sensitivity of detection of gene expression in spermatozoa that yielded only low amounts of RNA upon extraction, RT-PCR products were in turn used as templates in a second round of PCR using the appropriate nested oligonucleotide primers. Primer pairs used for PCR were designed over regions specific for each isoform containing intronic sequences, as listed below with the size of the amplicon:
GGCTGAGAGTGGAGAAGGTG; GCTGTGGCAGAAGAAAGTCC (Slc12a4,NM_009195; 733 bp).
ACACTTCCCGGTCTGTATGC; GACCGAGGGAAAGAAGATCC (Slc12a6, NM_133649; 379 bp).
AACAAGCTGGCACTGGTCTT; GACTTCTGGGCGTCTTTGAG (Slc12a7, NM_011390; 530 bp).
Additional reverse primers used for the second round of nested PCR for sperm RNA were: TAGGGGCCATTGAGATCTTG (Slc12a4, 383 bp), GACTTGGCTGATGGCTTTTC (Slc12a6, 285 bp), GGCACTGAGGACACACCTTT (Slc12a7, 377 bp).
For the identification of the PCR products, signal bands were excised and purified to be sequenced in the central laboratory of the university.
Slc12a7 oligonucleotide primers used for PCR of its mRNA and its subsequent sequencing of the full length amino acid-encoding region are given below, with the position of each corresponding base pair in the reference mRNA sequence NM_011390 in parentheses.
Forward primers: GCGAGGGACAGCAGAGTCTA (45), GGAAAACAGCCCTTTCATCA (213), AACAAGCTGGCACTGGTCTT (892), CCAGTGGTGTCTTCCTGGAT (1184), TCCTGCATAGTGCTGTTTGG (1474), CCCCCACATACCAAGAACTG (2122), CAGTCCAACGTCAGGAGGAT (3103).
Reverse primers: CCAGCTTGTTCAGCAGTGAT (350), CAACAGCACCTCCAAACTCA (676), CGGTTCCCTAGAAGGCAGAC (1010), GGCACTGAGGACACACCTTT (1268), GACTTCTGGGCGTCTTTGAG (1421), GGGGTGCTTTACACACTGCT (2199), CTGTGGTATGGGATGCAGTG (2962), CCAGAGCAGTGGCTATCACA (3426).
Flow cytometric data from different treatments tested as one group in the experiment were analyzed using the computer software SigmaStat (version 2.03; SPSS Inc., Erkrath, Germany) with one-way repeated measures of analysis of variance. In each experiment, the volume index for each treated sample was calculated from its laser forward scatter signal and expressed as a ratio of the control sample in the same experiment at the same incubation time point. Statistical differences of each treatment from the control were then tested with the Dunnett method. Differences were considered statistically significant at P < 0.05.
Effects of KCC Inhibitors on Murine Sperm Volume
When spermatozoa were released from the cauda epididymidis into medium that mimicked uterine fluid osmolality in the presence of the broad-spectrum channel inhibitor quinine, which was shown previously to inhibit RVD, they underwent an increase in the cell size compared with the control, as reflected by the increase in the laser forward scatter signals. This was already detected at 5 min of incubation and was maintained at 75 min (Fig. 1). None of the KCC inhibitors at any concentration tested had any effect at 5 min of incubation (data not shown). At 75 min, bumetanide treatment did not significantly affect sperm volume at low doses, and only at 1 mM did it cause cell swelling to a lesser extent than that caused by quinine. On the other hand, furosemide at 100 µM caused a significant increase in cell size, but increasing the concentration up to 1 mM did not lead to any further swelling. Treatment with increasing doses of DIOA showed biphasic effects, with swelling at concentrations of 10 µM and 20 µM but a tendency of shrinkage when doses reached 100 µM, although the shrinkage was statistically nonsignificant (Fig. 1, lower panel). A detailed time course using the effective doses of 300 µM furosemide and 10 µM DIOA illustrated that the maximal effects were obtained at 60–75 min of incubation (Fig. 2). Sperm viability in all media tested, as indicated by the exclusion of the DNA dye PI, was maintained over the incubation, still attaining 51%–92% at 75 min. There was no significant difference in viability between the control and any concentration of inhibitors used.
|
|
Effects of KCC Inhibitors on Human Sperm Volume
Bumetanide (50–1200 µM), furosemide (300-1000 µM), and DIOA (10–100 µM), including concentrations found to cause swelling of murine spermatozoa, showed no effect when tested on human ejaculate spermatozoa incubated at cervical mucus osmolality of 290 mmol/kg (Fig. 3). An analog of bumetanide, H74, also was tested. At concentrations reported to inhibit KCC activities in human erythrocytes [26], it showed no effect on sperm volume, with volume indices of 1.008 ± 0.035, 1.000 ± 0.021, and 1.006 ± 0.025 for 50, 100, and 200 µM H74 respectively (n = 6 to 8 in each group). Viability of sperm incubated in all concentrations of drugs tested remained high, with mean values of each treatment group >90%.
|
Analysis of Murine Testicular and Sperm mRNA of KCC1, KCC3, and KCC4, and Nucleotide Sequencing
Initially, RNA was extracted from the murine testis for RT-PCR in search of the expression of KCCs, as the yield of RNA in epididymal sperm extracts was very low. Amplicons in sizes corresponding to the expected number of nucleotide base pairs were obtained for Slc12a4 (733 bp), Slc12a6 (379 bp), and Slc12a7 (530 bp) (Fig. 4). The base pair sequences of the PCR products were obtained, and the correct polynucleotide sequences of the corresponding mRNA were confirmed using a BLAST search.
|
When total RNA extracted from pure cauda epididymidal spermatozoa collected by tubule cannulation and luminal perfusion was subjected to nested RT-PCR, amplicons of the expected smaller sizes were obtained for Slc12a6 (285 bp) and Slc12a7 (377 bp) but not for Slc12a4 (Fig. 5). Identities of the former two sperm mRNA were confirmed by sequencing of the PCR products.
|
Since Slc12a7 was the only sperm protein detected among the cotransporter isoforms (see below), the entire nucleotide sequence from positions 45–3426 of NM_011390, covering the region encoding the whole protein amino acid sequence, was obtained from the sequencing of the RT-PCR amplicons from mRNA extracted from the testis. The resulting sequence was 100% identical to that of the reference sequence.
Western Blotting of the Murine Sperm SLC12A4, SLC12A6, and SLC12A7
When murine sperm proteins separated by gel electrophoresis were probed with commercially available isoform-specific antibodies, a signal band within the expected range of 120 kDa was obtained for SLC12A7. However, no signal bands of the appropriate sizes were detectable for SLC12A4 and SLC12A6, although positive signals were exhibited by proteins extracted from the cardiac atrium and the brain serving as positive controls for the respective cotransporters (Fig. 6).
|
In view of the positive finding of SLC12A7 in murine sperm, human sperm proteins were also probed by Western blotting for this KCC isoform, which, as in the mouse, also has 1083 amino acids. No signal band could be detected around the core peptide size of 120 kDa or larger in case of glycosylation (data not shown).
The involvement of KCCs in RVD is best documented in the erythrocytes of many species, including humans. Together with the Na/K/2Cl cotransporter (NKCC), which facilitates regulatory volume increase (RVI) to counteract shrinkage in hyperosmotic environments, these cation-chloride cotransporters play an important role in cell volume regulation. To investigate the physiologic importance of KCCs in sperm RVD, the commonly used KCC inhibitors were employed to study their effects on sperm volume when the cells were challenged with a physiologic hypoosmolality mimicking that of cervical mucus or uterine fluid. Among these inhibitors, DIOA is the most specific. KCC in erythrocytes is characterized by its inhibition by DIOA and the relative insensitivity to bumetanide [3]. The latter is highly effective in the suppression of NKCC, with complete inhibition at 30 µM and an IC50 of 1 µM in kidney cells and fibroblasts [27, 28]. Nevertheless, KCCs are weakly sensitive to bumetanide (0.1–2 mM) [27, 29], which has a lower affinity for KCC4 than the other three isoforms [20]. In murine spermatozoa, cell volume increases by bumetanide were only detectable when concentrations reached 1 mM. On the other hand, an effect of higher magnitude was obtained using 100 µM furosemide, which is consistent with the pharmacologic characteristics of KCC activity. DIOA significantly increased sperm size at 10 µM and 20 µM, the same dose range effective in inhibiting KCC activities of some somatic cells, such as rat pancreatic cells [6] and human glioma cells [4]. At higher concentrations, however, the effect disappeared, and at 100 µM there was a tendency of sperm to shrink, although this shrinkage was statistically nonsignificant. It has been reported in human erythrocytes that high concentrations of DIOA cause nonspecific leakage of K+ ions, resulting in water efflux and cell volume decrease [30].
Whereas clear effects were observed in murine spermatozoa, similar doses of bumetanide, furosemide, and DIOA did not affect volume regulation by human spermatozoa where the application of the wide spectrum ion channel blocker quinine and its swelling effects confirmed the occurrence of RVD in the cells used in those experiments. To consolidate these negative results, another specific inhibitor of KCC, H74, which has been reported to inhibit KCC activities in human erythrocytes [26] and is not commercially available, was tested and also found to have no effect. This discrepancy between human and murine sperm responses adds to previously reported species differences in their RVD mechanisms, including the involvement of the chloride channel CLNS1A (also known as ICln) and the insensitivity to the Cl– channel blocker DIDS of murine sperm RVD in contrast to human sperm, which probably use CLCN3 for this function [19, 31, 32]. It is unclear at this stage what extent of such discrepancy is purely attributed to species differences and what extent is attributed to the differences in the experimental protocols. Whereas murine sperm were released from the storage site in the epididymis directly into osmolality of uterine fluid, human sperm could only be obtained from ejaculates where liquefaction needs to occur before the cells can be handled in medium with cervical osmolality of 290 mmol/kg. The nonphysiologic thorough mixing of the ejaculated sperm-rich fraction coming from the epididymis with the remaining 90% of the ejaculated volume of prostate and seminal vesicle secretions, as in routine semen analysis, subjects the spermatozoa to an osmolality of around 330 mmol/kg in liquefied semen. This means that such sperm would already have undergone a first round of RVD before the second round in the experimental protocol, which only offered a challenge of around 40 mmol/kg, in contrast to about 100 mmol/kg for murine sperm. Nevertheless, this does not diminish the physiologic significance of such a human sperm RVD, as its inhibition can lead to the failure of mucus penetration [13].
As there is no pharmacologic distinction between the different KCC isoforms, identification of the potential cotransporter in murine sperm was sought at the molecular level. Although SLC12A4 is considered to be a housekeeping transporter that maintains volume homeostasis of all cells (see review in Gamba [20]), and indeed was found to be expressed in the testis, it was absent from epididymal spermatozoa at both the mRNA and the protein levels. SLC12A5, which has been reported exclusively in neural tissues, was not examined in the present study, since this isoform is known to be volume insensitive and therefore does not play any role in cell volume regulation [33]. Slc12a6 transcripts were found in the testis as well as in epididymal spermatozoa, but the protein was not detectable in spermatozoa. The only isoform revealed in spermatozoa at present at both the mRNA and protein levels was Slc12a7. A search of the database derived from Shima et al. [34] suggests that transcripts of Slc12a4 are present in Sortoli cells, myoid cells, and prepubertal spermatogonia. Slc12a5 and Slc12a6 are absent from the testis, and Slc12a7 is present in spermatogonia A and B. Another database generated from microarray experiments provided by Schultz et al. [35] indicated the absence of all the KCC isoforms from adult germ cells, except for a weak but significant signal for Slc12a7. In the present study, direct detection of Slc12a7 transcripts has been achieved using the nested RT-PCR technique on RNA extracted from the epididymal spermatozoa, and the expression of the protein in these cells was verified by Western blotting. Murine SLC12A7 has 1083 amino acids and an estimated molecular weight of the core peptide of 119 kDa [20], with 4–7 predicted N-glycosylation sites. Electrophoretic mobility of the signal band revealed by Western blotting indicated a size around 130 kDa. This may represent a glycosylated protein, and it could be similar to the wide signal bands spanning around 145 kDa reported for murine neural tissues [36]. The full sequence of the RT-PCR product of 377 bp from murine sperm Slc12a7 was found to be 100% identical to that published in the database (GenBank accession no. NM_011390). This represents almost the full length of the transcribed amino acid sequence comprising the extracellular loop between the fifth and sixth transmembrane domains, and it includes the four potential N-glycosylation sites in this extracellular domain, which contains the major variation in the amino acid sequences among all KCC isoforms. Using testicular mRNA, the Slc12a7 nucleotide sequence in the entire 3249-bp open reading frame was 100% identical to the known sequence in the above database.
It has been shown in erythrocytes that KCC is only activated by isotonic swelling caused by an increase in intracellular ionic strength; KCC is not activated by hypotonic swelling that induces taurine efflux and instead activates K+ and Cl– channels [37]. This is in contrast with results reported in various transfected cells in which hypotonic swelling activates KCC (Mercado et al. [29], also see Wehner et al. [2]). Although SLC12A7 is the least known among the KCC isoforms, it has been tested in transfected Xenopus oocytes to be the isoform best activated by hypo-osmotic swelling [29]. The physiologic role of SLC12A7 is poorly understood. Slc12a7 knockout mice are viable and fertile, despite postnatal development of deafness due to the loss of cochlea outer hair cells [38].
In view of the previous findings, it appears that sperm RVD employs more than one mechanism, which is a common feature in somatic cells [1]. In murine spermatozoa, this includes effluxes of organic osmolytes, particularly those of epididymal origin [19, 39], and effluxes of K and Cl ions via separate K+ and Cl– channels [32, 40], as well as the KCC SLC12A7. From the magnitude of the increases in cell volume obtained by various channel and transporter blockers, there is no marked difference to reflect the dominance of any particular efflux mechanism. A notable finding in all these studies is that the maximum inhibition is consistently achieved by quinine, which was included in every experiment for comparison. Quinine is a nonselective channel blocker that affects not only volume-sensitive K+ channels [41] and anionic channels [42] but also KCC [43] and organic osmolyte efflux [44, 45]. This indicates that physiologically, sperm RVD indeed is accomplished by multiple mechanisms, perhaps a means to ensure the accomplishment of this crucial process in natural fertilization, the significance of which has been outlined in the Introduction. Differences in the RVD mechanisms between murine and human spermatozoa caution against the use of a mouse model in the search for clinical applications.
ACKNOWLEDGMENTS
The authors thank Jolanta Körber for technical assistance, and Raphaele Kürten, Sabine Rehr, and Daniela Hanke for semen analysis. The encouragement and support from Professor W. Weber (Department of Biology, University of Münster) and Professor E. Nieschlag (Institute of Reproductive Medicine) is gratefully acknowledged.
FOOTNOTES
3Current address: ZMNH Centre for Molecular Neurobiology, Institute for Neural Signal Transduction, Hamburg, Germany. 
1Supported by the Deutsche Forschungsgemeinschaft (grant no. YE37/6-1.
Correspondence: 2 C.H. Yeung, Institute of Reproductive Medicine, Domagkstrasse 11, D-48129 Münster, Germany. FAX: 49 251 835 6093; e-mail: chinghei.yeung{at}ukmuenster.de
Received: 23 May 2006.
First decision: 19 July 2006.
Accepted: 28 August 2006.
REFERENCES
This article has been cited by other articles:
|
|
 |
|
  C Callies, T G Cooper, and C H Yeung Channels for water efflux and influx involved in volume regulation of murine spermatozoa Reproduction, October 1, 2008; 136(4): 401 - 410. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. T. Page, J. K. Amory, and W. J. Bremner Advances in Male Contraception Endocr. Rev., June 1, 2008; 29(4): 465 - 493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A M Petrunkina, D Waberski, A R Gunzel-Apel, and E Topfer-Petersen Determinants of sperm quality and fertility in domestic species Reproduction, July 1, 2007; 134(1): 3 - 17. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
