Biol Reprod Lalor Postdoctoral Fellowships -- Application Deadline January 15, 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print August 9, 2006.
Biol Reprod 2006, 10.1095/biolreprod.106.052167
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
75/5/785    most recent
biolreprod.106.052167v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Coussens, M.
Right arrow Articles by Allsopp, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coussens, M.
Right arrow Articles by Allsopp, R.
Agricola
Right arrow Articles by Coussens, M.
Right arrow Articles by Allsopp, R.
BIOLOGY OF REPRODUCTION 75, 785–791 (2006)
DOI: 10.1095/biolreprod.106.052167
© 2006 by the Society for the Study of Reproduction, Inc.


Research Article

Regulation and Effects of Modulation of Telomerase Reverse Transcriptase Expression in Primordial Germ Cells During Development1

Matthew Coussens , Yukiko Yamazaki , Stefan Moisyadi , Ryota Suganuma , Ryuzo Yanagimachi , and Richard Allsopp 2

Institute for Biogenesis Research, University of Hawaii, Honolulu, Hawaii 96822

ABSTRACT

Telomere length maintenance in the germ line from generation to generation is essential for the perpetuation of eukaryotic organisms. This task is performed by a specialized reverse transcriptase called telomerase. While this critical function of telomerase has been well established, the mechanisms that regulate telomerase in the germ line are still poorly understood. We now show, using a Pou5f1-GFP transgenic mouse model, that telomerase suppression in quiescent male primordial germ cells (PGCs) is accompanied by a decrease in expression of murine telomerase reverse transcriptase (TERT). To further assess the role of TERT in quiescent PGCs, we developed a chicken Actb gene promoter/cytomegalovirus enhancer (CAG)-Tert transgenic mouse strain that constitutively expresses murine TERT. Telomerase activity was detected in quiescent PGCs from CAG-Tert transgenic embryos, demonstrating that re-activation of TERT expression is sufficient to restore telomerase activity in these cells and implying that TERT expression is an important mechanism of telomerase regulation in PGCs. Fluorescence-activated cell-sorting (FACS) analysis of PGC frequency and cell cycle status revealed no effect of either overexpression or deficiency of TERT in CAG-Tert transgenic mice or Tert knock-out mice respectively. These results demonstrate that TERT per se does not affect proliferation or development of PGCs, in contrast with recent studies that suggest that TERT has a telomere-independent effect in certain stem cells. It is possible that the direct effect of TERT on cell behavior may be dependent on cell type.

embryo, gamete biology

INTRODUCTION

Telomerase is an essential ribonucleoprotein complex that functions to complete the replication of telomeres, essential genetic elements that cap the ends of all eukaryotic chromosomes. There are two essential components of telomerase: the telomerase RNA component [1], which contains a short motif that serves as a template for the addition of new telomeric DNA onto the end of the telomere, and telomerase reverse transcriptase (TERT) [2], which is the catalytic component of telomerase. In sexually reproducing eukaryotes, the primary function of telomerase is to maintain telomere length in the germ line from generation to generation [3].

In the absence of telomerase, the normal DNA replication machinery cannot completely replicate the ends of telomeres [4]. Thus gradual telomere attrition occurs in cells that proliferate in the absence of telomerase [5, 6]. Soon after blastocyst implantation in humans, telomerase gradually becomes suppressed in most tissues of the developing embryo. By adulthood, most human tissues, with the exception of the germ line and certain highly proliferative tissues such as the hematopoietic system, lack detectable telomerase altogether. As a result, telomeres gradually shorten during aging in humans, eventually triggering cell senescence once one or more telomeres become critically short [7, 8]. Activation of telomerase through ectopic expression of human TERT in a number of different types of human somatic cells in vitro has been shown to both prevent telomere shortening and immortalize the cells [9, 10]. While the role of telomeres and telomerase as ultimate effectors of replicative life span of human cells is now well established, the mechanisms that regulate suppression of telomerase in somatic cells and tissues and maintenance of active telomerase in the germ line are still poorly understood.

Both male and female germ cell lineages are derived from specialized stem cells in the embryo called primordial germ cells (PGCs). The development of PGCs and gonads has been well established in mice [11], where PGCs are first detectable in the hindgut of Day 7 (d7.0) embryos as a very small population (n{approx}50) of alkaline phosphatase-positive cells [12]. At d9.5, PGCs begin to migrate from the hindgut to the genital ridge. This migration is complete by d11.5, and PGCs continue to proliferate in the immature gonad until d13.5 when they number approximately 25 000 per gonad. At this point, females enter meiosis and arrest in prophase I until sexual maturity. In male embryos, PGCs enter a state of quiescence until shortly after birth when they differentiate into spermatogonia of the developing testis.

In both humans and mice, telomerase activity, as assessed by a highly sensitive PCR-based assay (TRAP assay) [13], is detectable in oocytes [14, 15] and the testis [13, 16], but not in mature spermatozoa [15, 17]. In mice, telomerase activity has also been reported in highly enriched samples of mitotically active PGCs, but not quiescent male PGCs [15], suggesting that there may be a physiologically relevant switch in telomerase activity as PGCs enter a state of growth arrest. Telomerase activity would, therefore, be switched back on again at some point during testicular development. In the present study, we have rigorously established that telomerase is downregulated in male PGCs as they become quiescent, and we have begun to assess the mechanism of telomerase suppression by examining the role that TERT expression may have in this process. We found that inhibition of TERT expression partially, if not entirely, accounts for the suppression of telomerase in male PGCs during development. Furthermore, recent studies [1820], including our own unpublished work, have demonstrated that alteration in TERT expression can affect the behavior of cells, including stem cells, through a mechanism that is independent of telomerase. Finally, we have also examined the consequences of TERT overexpression and deletion in PGCs from Tert transgenic and Tert knock-out mice, respectively.

MATERIALS AND METHODS

Mice

The Pou5f1 (more commonly known as Oct4) gene promoter-GFP transgenic mouse strain [21] and Tert knockout strain [22] were kindly provided by Drs. Jeff Mann (University of Melbourne) and Lea Harrington (University of Toronto), respectively. All B6D2F1 and C57BL6/J mice were purchased from the National Cancer Institute (NCI), and CD-1 mice were purchased from Charles River Laboratories. The chicken Actb gene promoter/cytomegalovirus enhancer (CAG)-Tert transgenic strain was developed as described below. Mice were fed with a standard diet and maintained in a temperature- and light-controlled room (22°C, 14L:10D; light starting at 0700 h), in accordance with the guidelines of the Laboratory Animal Services at the University of Hawaii and the Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Resources National Research Council (DHEW publication 80–23, revised in 1985). The protocol for animal handling and treatment procedures was reviewed and approved by the Animal Care and Use Committee at the University of Hawaii.

CAG-Tert Transgenic Construct Assembly

A version of murine Tert cDNA [23] containing a short, unique 3' untranslated region (to allow subsequent analysis of transgene expression) was sub-cloned into the EcoRI site of a chicken Actb gene promoter/cytomegalovirus enhancer (CAG) expression construct. A SalI-HindIII fragment containing the CAG-Tert cassette was then sub-cloned into the pMOD-3 vector (Epicentre) to generate the pMOD3-CAG-Tert construct. The transposon flanked by its mosnic end (ME) sequences was linearized by digesting the pMOD3-CAG-Tert construct with PvuI, resulting in a 7638-bp fragment containing the active transposon (EZ:TN transposon). The transgenic construct was resolved on a 1% agarose gel, purified with the QIAquick Gel Extraction Kit (Qiagen) and used for transposome assembly as previously described [24].

Transgenesis

Transgenesis with the transposable transgenic construct (ME-CAG-Tert-ME) was performed as previously described [24]. Pups were screened for the presence of the transgene by PCR using primers specific for the transgene construct. Two of 16 viable pups were positive for transgene integration. One of these founder mouse strains was subsequently shown to express the Tert transgene (as described in Results).

Fluorescence-Activated Cell-Sorting (FACS) Analysis and Purification of PGCs

Pou5f1-GFP males (homozygous for the Pou5f1-GFP transgene) were bred with either B6D2F1 females or CAG-Tert transgenic females to allow generation of Pou5f1-GFP transgenic embryos or Pou5f1-GFP/CAG-Tert double transgenic embryos, respectively. Primordial germ cells were isolated from either the lower half of the embryo (d9.5 and d10.5 embryos) or from male gonads (d12.5, d15.5, or d16.5 embryos). To prepare single-cell suspensions containing PGCs, the embryonic sections or gonads were treated for 3 min with trypsin/EDTA at 37°C and then further dissociated by pipetting before filtering through a 100-µm nylon filter. Trypsin was inactivated with 10% fetal bovine serum (FBS)/PBS solution and cells were centrifuged, washed twice in 2% FBS/PBS solution, and finally resuspended in 2% FBS/PBS for FACS analysis and sorting. All FACS analysis was performed on a Beckman/Coulter Elite FACS machine. To exclude nonviable cells from the analysis, 7-actinomycinD (7-AAD; 5 µl) was added to all samples 10 min before FACS analysis. For purification of PGCs, all samples were double sorted.

Analysis of Telomerase Activity

Telomerase activity was assessed using the TRAP assay (Chemicon), with slight modifications to the manufacturer's protocol as previously described [25]. Briefly, for analysis of single-cell suspensions prepared from whole embryos, cells (n = 1000 per embryo) were sorted into 96-well plates containing 50 µl [(3-cholamidopropyl)dimethylammonio]-propanesulfonic acid (CHAPS) lysis buffer and 20 units of RNaseout (Invitrogen) per well. Cells were lysed on ice for 30 min. Thirty cycles of PCR were performed using 1 µl of each embryo sample (final reaction volume, 25 µl). The TRAP analysis of telomerase activity in PGCs was performed the same way, except 32 cycles of PCR were performed, and 1.5 µl cell extract was used per TRAP reaction.

Reverse Transcription-PCR

In all analyses, PGCs or embryonic cells were sorted directly into 50 µl RT-PCR lysis buffer (Ambion) containing 20 units of RNaseout (Invitrogen). Reverse transcription (RT) was performed with Superscript III (Invitrogen) for 45 min at 42°C using an oligo-dT primer. All RT reactions were performed using 1 µl of sample. Forty cycles of PCR (94°C, 30 sec; 60°C, 30 sec; 72°C, 1 min) were then performed with Taq DNA polymerase, followed by 20 more cycles of nested PCR. Analysis of cyclin D1 expression was performed using previously described primers [26]. All RT and PCR reactions were performed on a PTC-100 PCR machine (MJ Research).

Quantitative RT-PCR

In all FACS analyses, 1500 PGCs were sorted directly into 50 µl Trizol (Invitrogen) containing 20 units of RNaseout (Invitrogen). RNA was extracted and precipitated using linear acrylamide (Ambion) as a carrier. Reverse transcription was performed using an oligo-dT primer and Superscript III (Invitrogen). All RT reactions were performed at 42°C for 45 min using 300 cell equivalents of RNA as template. Real-time PCR was performed using the Superscript III Cell Direct qPCR (quantitative PCR) kit (Invitrogen) and the LightCycler system (Roche). To normalize amounts of RT product, Hprt1 mRNA was used as an internal control. Real-time PCR reactions were performed using the following primers:

Hprt1-Forward: TCCTCCTCAGACCGCTTTT

Hprt1-Reverse: CCTGGTTCATCGCTAATC

Tert-Forward: GTGAACAGCCTCCAGACAG

Tert-Reverse: TTCCTAACACGCTGGTCAAAGGGA

All primers were designed to span intron/exon boundaries, yield single amplicons (≤120 bp) as measured by dissociation curves, and were shown to not amplify genomic sequences.

Each real-time PCR reaction mix contained 1 µM of each primer, 200 µM dNTPs, 2.5 mM magnesium chloride (MgCl2), and 2 µl of first-strand cDNA sample. Reaction products were detected using SybrGreen (Invitrogen). All PCR reactions were performed for 45 cycles (94°C, 5 sec; 55°C, 10 sec; 72°C, 10 sec), followed by continuous melt curve analysis to ensure product accuracy. Standard curves (Cp plotted against the log of relative cDNA concentration) for Hprt1 and Tert amplification generated by serial dilutions of first-strand cDNA were linear through a range spanning at least one log greater and less than the amount of cDNA used in the test reactions. All calculations of the relative amount of Tert mRNA, performed using the 2{Delta}{Delta}Cp method, were carried out in triplicate.

Cell-Cycle Analysis

Primordial germ cells were purified by FACS and fixed overnight in ethanol at 4°C. The next day, fixed cells were washed twice with PBS and then stained for 3 h at 4°C in 3.8 mM sodium citrate buffer containing 50 µg/ml propidium iodide and 0.25 µg/ml RNaseA before FACS analysis.

RESULTS

Analysis of Telomerase Activity and TERT Expression in Purified PGCs

Preliminary data by Dolci et al. [15] suggest that telomerase activity is suppressed as PGCs stop dividing and become quiescent by d14.5 in male murine embryos. However, the proliferating PGC samples in this study were enriched but not pure, and, therefore, it remains possible that the observed telomerase activity was due to contaminating cells. To confirm that telomerase is suppressed as male PGCs cease proliferating, we assessed telomerase activity by the TRAP assay in PGCs purified by FACS from Pou5f1-GFP transgenic [21] mouse embryos at various stages of development (Fig. 1A). Previous work has shown that POU5F1 is essentially exclusively expressed in PGCs in mouse embryos by d8.5 [21]. In agreement with Dolci et al. [15], we found that telomerase activity is present in FACS-purified male PGCs at d12.5 but not detectable in quiescent male PGCs at d15.5 or d16.5 (Fig. 1). Telomerase activity was also present in PGCs at earlier stages of development (d9.5 and d10.5) at levels similar to that observed in d12.5 male PGCs (Fig. 1B). Importantly, this analysis was done on small numbers of proliferating PGCs (d9.5–d12.5) that consistently showed 100% purity on the basis of alkaline phosphatase activity (data not shown).


Figure 1
View larger version (40K):
[in this window]
[in a new window]
 
FIG. 1. Analysis of telomerase activity and TERT expression in PGCs during development. A) Purification of PGCs from Pou5f1-GFP transgenic embryos using FACS. Single-cell suspensions were prepared from Pou5f1-GFP embryo sections (d9.5 and d10.5) or male gonads (d12.5, d15.5, and d16.5) to facilitate FACS purification of PGCs. The gates for analysis and sorting of GFP + PGCs are shown. Also shown is an example of FACS analysis of d15.5 gonads from C57BL/6 embryos (non-transgenic). B) Analysis of telomerase activity in FACS-purified PGCs. Primordial germ cells (n = 50 for each sample) from Pou5f1-GFP embryos at various stages of development were purified by FACS for analysis of telomerase activity by the TRAP assay. Stage of development is indicated above each lane. NIH3T3 cells were used as a positive control (n = 500). The internal control (IC) for the TRAP assay is indicated by the arrow. C) Analysis of TERT expression using real-time RT-PCR. Primordial germ cells (n = 1500) from Pou5f1-GFP transgenic embryos at the indicated stages of development were purified using FACS for extraction of RNA. First strand cDNA was generated using an oligo-dT primer, and 300 cell equivalents of RNA were used in all real-time PCR reactions. Real-time PCR was performed using the LightCycler system (Roche). Hprt1 mRNA was used as an internal control. Values are an average of three experiments. Bars = SEM. No difference was detected between Tert mRNA levels of d10.5 and d12.5 PGCs (P > 0.1; ANOVA)

To assess whether suppression of telomerase in quiescent male PGCs involves downregulation of TERT expression, we performed quantitative RT-PCR (qRT-PCR) analysis of relative Tert mRNA levels. Similar levels of Tert mRNA were observed in d10.5 and d12.5 PGCs, but was not detected in quiescent male PGCs (d15.5 or d16.5) (Fig. 1C). These results demonstrate that suppression of telomerase in quiescent male PGCs is accompanied by downregulation of TERT expression.

Expression of TERT Is Sufficient to Restore Telomerase Activity in Quiescent PGCs

A number of potential mechanisms for the regulation of telomerase activity have been identified, including regulation of the RNA component of telomerase [27], translocation of TERT between the cytoplasm and nucleus [28], and post-translational modification of TERT [29], in addition to regulation of TERT expression [2]. Therefore, to assess whether modification of TERT expression is the primary mechanism for regulation of telomerase activity during PGC development, we created a transgenic mouse strain in which TERT expression is driven by the chicken Actb gene promoter/cytomegalovirus enhancer (CAG) promoter. This CAG-Tert strain expresses the Tert transgene and has approximately 2.5-fold higher telomerase activity levels in whole embryos compared with non-transgenic embryos (P = 0.01) (Fig 2, A and B). To assess the effect of TERT overexpression in PGCs, we crossed CAG-Tert transgenic mice with Pou5f1-GFP transgenic mice (each strain was homozygous for their respective transgenes) and used FACS to isolate PGCs from embryos at various stages of development. As a control, PGCs were also isolated from Pou5f1-GFP embryos. In mitotically active PGCs (d9.5–d12.5), we observed an approximately 2.3-fold elevation in telomerase activity of Tert transgenic embryos compared with controls (P ≤ 0.01) (Fig. 2, C and D). We also detected telomerase activity in quiescent male PGCs (d15.5 and d16.5) from Tert transgenic PGCs, but not in control quiescent PGCs. Real-time RT-PCR analysis of Tert mRNA levels demonstrated increased expression in d10.5–d16.5 PGCs from Tert transgenic animals (Fig. 2E), consistent with the observed elevated levels of telomerase activity. These data demonstrate that reexpression of TERT is sufficient to restore telomerase activity in quiescent male PGCs.


Figure 2
View larger version (74K):
[in this window]
[in a new window]
 
FIG. 2. Overexpression of TERT in quiescent PGCs is sufficient to restore telomerase activity. A) Telomerase activity and transgene expression in CAG-Tert transgenic embryos. The CAG-Tert transgenic strain (transgenesis method described in Materials and Methods) was crossed with C57BL/6 mice, and single cell suspensions were prepared from individual d12.5 embryos for analysis of telomerase activity (upper panel) and transgene expression (lower panel). Genotype was subsequently assessed by PCR on a small tissue section from each embryo. A typical result is shown for a transgenic and non-transgenic embryo. Transgene expression was assessed by RT-PCR with transgene-specific primers on oligo-dT purified mRNA. Also shown are expression levels of Gapdh mRNA as a control for PCR efficiency and gel loading. B) Quantitative analysis of telomerase activity in CAG-Tert transgenic and non-transgenic embryos. Telomerase activity was measured using the TRAP assay. All d12.5 embryos (non-transgenic [non-Tg], n = 5; transgenic [Tg], n = 6) from a CAG-Tert x C57BL/6 cross were used in this analysis. The TRAP assay was also performed on 3-fold serial dilutions of some Tg and non-Tg embryo extracts to ensure that measured telomerase activity for all samples was within the linear range (data not shown). Telomerase activity was significantly greater for extracts prepared from transgenic animals (P = 0.01; Student t-test). C) Analysis of telomerase activity in PGCs from CAG-Tert transgenic embryos. CAG-Tert mice were bred to homozygosity and then crossed with Pou5f1-GFP mice to generate CAG-Tert/Pou5f1-GFP double transgenic (DT) embryos. Primordial germ cells (n = 200 per embryo) were isolated using FACS from individual embryos at the various stages of development indicated above each lane. A sample blot is shown, with extracts from both DT and Pou5f1-GFP (ST) embryos. D) Quantitative analysis of telomerase activity in CAG-Tert transgenic and non-transgenic PGCs. Analysis of telomerase activity was performed on PGCs isolated from DT and ST embryos (n ≥ 5 at each stage of development). At each stage of development assessed, telomerase activity levels were significantly greater for DT PGCs compared with ST PGCs (indicated by the asterisk; P ≤ 0.01 at each stage of development; Student t-test). E) Analysis of TERT expression using real-time RT-PCR. Primordial germ cells (n = 1500) from ST and DT transgenic embryos at the indicated stages of development were purified using FACS and RNA was extracted. The RT and real-time PCR were performed as described in the caption to Figure 1. Values are an average of three experiments. Bars = SEM. At each stage of development assessed, Tert mRNA levels were significantly greater for DT PGCs than for ST PGCs (P ≤ 0.002 at each stage of development; Student t-test)

Analysis of the Effect of Modulation of TERT Expression on PGC Numbers and Cell-Cycle Status

Recent studies have found that TERT overexpression can stimulate proliferation and increase in frequency of cells, including stem cells [1820]. Furthermore, lack of telomerase in the murine germ line results in sterility through a telomere-dependent mechanism, though not until after several generations of successive breeding [3]. To determine whether TERT overexpression or deficiency affects PGC number, we assessed, using FACS, the frequency of PGCs within the embryonic gonad at d12.5 and d15.5 for CAG-Tert, early generation Tert knockout, and wild-type embryos (Fig. 3). Neither deficiency nor overexpression of TERT had a noticeable effect on PGC frequency as compared to controls. To assess the effect of altered TERT expression on cell-cycle status, we measured the frequency of S/G2/M (cycling) and G0/G1 (non-cycling) PGCs at d12.5 and d15.5 from CAG-Tert, early generation Tert knockout, and wild-type mice (Fig. 4A). In agreement with the lack of effect of altered TERT levels on PGC frequency (Fig. 3), we observed no appreciable difference in the frequency of cycling PGCs in CAG-Tert transgenic embryos or Tert knockout embryos. To further assess the effect of altered TERT expression on cell cycle status of quiescent male PGCs, we analyzed the expression of the proliferation marker cyclin D1 by RT-PCR in PGCs from Tert transgenic and knockout embryos, as well as wild-type embryos. For all strains, cyclin D1 expression was detectable in proliferating d12.5 PGCs, but not in quiescent male PGCs (Fig. 4B). Together, these data show that altered expression of TERT, either overexpression or deletion, does not affect frequency or cell-cycle status of PGCs.


Figure 3
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3. Effect of alteration of TERT expression on PGC frequency. Gonads were isolated from Pou5f1-GFP embryos (wt), Tert–/–/Pou5f1-GFP embryos (KO), and CAG-Tert/Pou5f1-GFP embryos (Tg), at d12.5 and d15.5 for FACS analysis of PGCs. The CAG-Tert/Pou5f1-GFP embryos were generated as described in the caption to Figure 2. To generate Tert–/–/Pou5f1-GFP embryos, Tert+/– mice were first bred with Pou5f1-GFP mice to generate mice heterozygous for both the Tert null allele and Pou5f1-GFP transgene. These Tert+/–/Pou5f1-GFP+/– mice were then crossed to generate Tert–/–/Pou5f1-GFP embryos (gonad samples not exhibiting GFP fluorescence were discarded). Tert–/– embryos were identified retrospectively by genotyping. To assess PGC frequency, the percentage of GFP-positive cells per embryo (gonads from the same embryo were pooled) was measured using FACS. The average frequency of PGCs per Tert–/– and CAG-Tert embryo is shown relative to the average frequency of PGCs in wt (Pou5f1-GFP) embryos (n ≥ 4 for each strain)


Figure 4
View larger version (37K):
[in this window]
[in a new window]
 
FIG. 4. Effect of alteration of TERT expression on cell cycle status of PGCs. A) Analysis by FACS of cycling PGCs from Tert knockout and transgenic embryos. PGCs were analyzed by FACS from either pooled embryos (CAG-Tert/Pou5f1-GFP and Pou5f1-GFP embryos) or individual embryos (Tert–/–/Pou5f1-GFP) at d12.5 and d15.5. Samples were fixed overnight and then stained with propidium iodide for FACS analysis of cell-cycle status the next day. Tert–/– embryos were identified retrospectively by genotyping. Sample cell-cycle histograms for PGCs from each strain at d12.5 and d15.5 are shown. The percentages of PGCs in the G1/G0 (non-cycling) and S/G2/M (cycling) stages of the cell cycle are indicated (average result from three experiments). B) Analysis of expression of the cell-cycle marker cyclin D1 in Tert knockout and transgenic embryos by RT-PCR. Primordial germ cells (n = 500) were analyzed by FACS from d12.5 and d15.5 embryos, as described in A, directly into RT-PCR lysis buffer. The lower panel shows the level of Gapdh mRNA as a control for PCR efficiency and gel loading

DISCUSSION

Telomerase is essential for the regulation of telomere length in the germ line, as has been demonstrated in telomerase-deficient mice [3], where the lack of telomerase in successive generations of mice causes unabated telomere shortening and, ultimately, sterility. Although regulation of telomerase in the germ line is poorly understood, a number of studies have now examined telomerase expression in the mammalian germ line. In the female germ line, as demonstrated in humans, telomerase appears to be constitutively expressed in both immature and mature oocytes, although perhaps at a higher level in the former [14]. Telomerase activity is also detectable in mature murine oocytes [15]. In the male germ line, as demonstrated in humans and mice, telomerase is expressed in the testis [13, 16], but is then repressed in the final stages of spermatogenesis [16, 17]. Following fertilization, telomerase is presumably reactivated in the male genome at some point during early development of the preimplantation embryo. In addition, preliminary analysis of telomerase activity in murine PGCs suggests that telomerase is active in proliferating PGCs and is then suppressed later in development when these cells enter a state of growth arrest in the male gonad [15]. We have now established that telomerase is suppressed during development of male PGCs by a mechanism that involves inhibition of TERT expression. Furthermore, we showed that altered expression of TERT in PGCs from telomerase deficient or transgenic embryos does not affect the behavior of these cells, implying that neither telomerase activity nor TERT per se are required for normal development or proliferation of PGCs.

The lack of detectable telomerase activity in most types of human somatic cell correlates with the absence of TERT expression [2]. In addition, telomerase activity can be restored and telomere length maintained in a number of human cell types by the ectopic expression of human TERT [9, 10]. These findings suggest that the primary mechanism of telomerase regulation is through suppression or activation of TERT expression. However, other mechanisms of telomerase regulation may also be important, including regulation of expression of the RNA component of telomerase [27], translocation of TERT between cytoplasm and nucleus [28], and TERT post-translational modification [29]. In the present study, we found that TERT expression is suppressed in quiescent male PGCs and that overexpression of TERT is sufficient to restore telomerase activity in these cells (Figs. 1 and 2). Although a possible effect of elevated TERT expression in non-PGC cells in CAG-Tert transgenic embryos cannot be ruled out, these data strongly suggest that the primary mechanism for regulation of telomerase activity in PGCs during development is at the level of TERT expression. This conclusion is consistent with other studies that show that telomerase activity and TERT expression are suppressed in quiescent cells [30, 31].

Recent studies have shown that altered TERT expression in various cell types, including stem cells, can not only affect telomerase activity, but can also have additional effects. In some human cancer cells, TERT has been shown to have pro-tumorigenic properties independent of telomere length maintenance [32], and suppression of TERT expression in human fibroblasts leads to attenuation of the DNA damage response [33]. In rodents, overexpression of TERT in cultured neuronal cells promotes resistance to apoptosis [34]. In addition, we found that overexpression of TERT in murine hematopoietic cells causes mild splenomegaly (unpublished results). Furthermore, elevated TERT expression has been shown to promote proliferation of epidermal stem cells [19, 20] and skin cells [18]. At least in studies involving rodents, it is improbable that this effect of altered TERT expression on cell behavior is due to prevention of telomere-mediated cell senescence or cell death, since rodents have relatively long telomeres [35]. In the present study, we found that deficient or elevated expression of TERT in PGCs does not affect PGC number or proliferation (Figs. 3 and 4). The Tert knockout mice used in this study were derived from a C57BL/6 Tert+/– strain with uncharacteristically short telomeres due to Tert haplo-insufficiency [36]. The lack of effect of TERT deficiency in PGCs from first generation knockout embryos (Fig. 3 and 4) is consistent with a lack of any overt phenotype or telomere dysfunction, as well as the normal litter size observed for first generation Tert knockout mice derived from this strain [36]. It has also been reported that TERT elevation does not affect hematopoietic stem cell frequency in transgenic mice that overexpress TERT in the hematopoietic system [37]. It is possible that the effect of TERT on cell behavior is dependent on cell type or, in the case of TERT overexpression, on the level of TERT expression.

Interestingly, in the CAG-Tert transgenic mice developed in this study, where TERT is also expected to be overexpressed in epidermal stem cells, we did not observe the markedly enhanced hair growth that was found upon induction of TERT expression in a Tet-inducible CAG-Tert strain [20]. While the reason for this is unclear, it could be that the Tet-inducible strain has significantly higher levels of TERT expression, or perhaps there is a mechanism, active during embryonic development, that dampens the effect of TERT overexpression in epidermal stem cells. Abnormal hair growth in another constitutively-expressing CAG-Tert transgenic strain was not reported [38], in agreement with our observations.

In conclusion, we have shown that telomerase is primarily regulated at the level of TERT expression during development of male PGCs, and that altered expression of TERT in PGCs does not affect their behavior in any overt manner, including entry into quiescence later in development. However, more subtle effects of altered TERT expression, for example on chromosome stability or DNA damage response [33], cannot be ruled out and will be of interest to assess in future studies. These observations also imply that transcriptional regulators of the Tert gene are important in the regulation of telomerase during development of male PGCs. While a number of transcription factors have been identified that affect TERT expression in cultured cells [39, 40], to our knowledge, none have been found to have a physiological role in the regulation of TERT expression in normal cells in vivo. It is also possible that expression of transcription factors that regulate telomerase in the germ line is dysregulated during progression of certain cancers, leading to reactivation of telomerase. Thus, it will be important to determine the factors involved in regulation of TERT expression in PGCs, not only from the standpoint of their role in fertility of the male germ line, but also as possible potential targets in cancer.

ACKNOWLEDGMENTS

We thank Lea Harrington and Scott Lozanoff for critical review of the manuscript, Gregg Maeda for excellent technical assistance, and Karen Selph and Jamie Newell for assistance with FACS sorting of PGCs.

FOOTNOTES

2 Correspondence: FAX: 808 956 7316; allsopp{at}hawaii.edu Back

1 Supported by National Institutes of Health grant P20RR16467-05, the Castle Foundation, and Research Centers in Minority Institutions award P20RR11091 from the National Center for Research Resources, National Institutes of Health to R.A. Back

Received: 3 March 2006.

First decision: 31 March 2006.

Accepted: 19 July 2006.

REFERENCES

  1. Greider CW, Blackburn EH, The telomere terminal transferase of Tetrahymena is a ribonucleoprotein enzyme with two kinds of primer specificity. Cell 1987 51:887-898[CrossRef][Medline]
  2. Nakamura TM, Morin GB, Chapman KB, Weinrich SL, Andrews WH, Lingner J, Harley CB, Cech TR, Telomerase catalytic subunit homologs from fission yeast and human. Science 1997 277:955-959[Abstract/Free Full Text]
  3. Blasco MA, Lee HW, Hande MP, Samper E, Lansdorp PM, DePinho RA, Greider CW, Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell 1997 91:25-34[CrossRef][Medline]
  4. Olovnikov A, A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon. J Theor Biol 1973 41:181-190[CrossRef][Medline]
  5. de Lange T, Shiue L, Myers RM, Cox DR, Naylor SL, Killery AM, Varmus HE, Structure and variability of human chromosome ends. Mol Cell Biol 1990 10:518-527[Abstract/Free Full Text]
  6. Greider CW, Futcher AB, Harley CB, Telomeres shorten during ageing of human fibroblasts. Nature 1990 345:458-460[CrossRef][Medline]
  7. Harley C, Telomere loss: mitotic clock or genetic time bomb?. Mutat Res 1991 256:271-282[CrossRef][Medline]
  8. Hemann MT, Strong MA, Hao LY, Greider CW, The shortest telomere, not average telomere length, is critical for cell viability and chromosome stability. Cell 2001 107:67-77[CrossRef][Medline]
  9. Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu CP, Morin GB, Harley CB, Shay JW, Lichtsteiner S, Wright WE, Extension of life-span by introduction of telomerase into normal human cells. Science 1998 279:349-352[Abstract/Free Full Text]
  10. Harley C, Telomerase is not an oncogene. Oncogene 2002 21:494-502[CrossRef][Medline]
  11. McLaren A, Primordial germ cells in the mouse. Dev Biol 2003 262:1-15[CrossRef][Medline]
  12. Ginsburg M, Snow MHL, McLaren A, Primordial germ cells in the mouse embryo during gastrulation. Development 1990 110:521-528[Abstract/Free Full Text]
  13. Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PL, Coviello GM, Wright WE, Weinrich SL, Shay JW, Specific association of human telomerase activity with immortal cells and cancer. Science 1994 266:2011-2015[Abstract/Free Full Text]
  14. Wright DL, Jones EL, Mayer JF, Oehninger S, Gibbons WE, Lanzendorf SE, Characterization of telomerase activity in the human oocyte and preimplantation embryo. Mol Hum Reprod 2001 7:947-955[Abstract/Free Full Text]
  15. Dolci S, Levati L, Pellegrini M, Faraoni I, Graziani G, Di Carlo A, Geremia R, Stem cell factor activates telomerase in mouse mitotic spermatogonia and in primordial germ cells. J Cell Sci 2002 115:1643-1649[Abstract/Free Full Text]
  16. Yamamoto Y, Sofikitis N, Ono K, Kaki T, Isoyama T, Suzuki N, Miyagawa I, Postmeiotic modifications of spermatogenic cells are accompanied by inhibition of telomerase activity. Urol Res 1999 27:336-345[CrossRef][Medline]
  17. Wright WE, Piatyszek MA, Rainey WE, Byrd W, Shay JW, Telomerase activity in human germline and embryonic tissues and cells. Dev Genet 1996 18:173-179[CrossRef][Medline]
  18. Gonzalez-Suarez E, Samper E, Ramirez A, Flores JM, Martin-Caballero J, Jorcano JL, Blasco MA, Increased epidermal tumors and increased skin wound healing in transgenic mice overexpressing the catalytic subunit of telomerase, TERT, in basal keratinocytes. EMBO J 2001 20:2619-2630[CrossRef][Medline]
  19. Flores I, Cayuela ML, Blasco MA, Effects of telomerase and telomere length on epidermal stem cell behavior. Science 2005 309:1253-1256[Abstract/Free Full Text]
  20. Sarin KY, Cheung P, Gilison D, Lee E, Tennen RI, Wang E, Artandi MK, Oro AE, Artandi SE, Conditional telomerase induction causes proliferation of hair follicle stem cells. Nature 2005 436:1048-1052[CrossRef][Medline]
  21. Szabo PE, Hubner K, Scholer H, Mann JR, Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dev 2002 115:157-160[CrossRef][Medline]
  22. Liu Y, Snow BE, Hande MP, Yeung D, Erdmann NJ, Wakeham A, Itie A, Siderovski DP, Lansdorp PM, Robinson MO, Harrington L, The telomerase reverse transcriptase is limiting and necessary for telomerase function in vivo. Curr Biol 2000 10:1459-1462[CrossRef][Medline]
  23. Greenberg RA, Allsopp RC, Chin L, Morin GB, DePinho RA, Expression of mouse telomerase reverse transcriptase during development, differentiation and proliferation. Oncogene 1998 16:1723-1730[CrossRef][Medline]
  24. Suganuma R, Pelczar P, Spetz JF, Hohn B, Yanagimachi R, Moisyadi S, Tn5 transposase-mediated mouse transgenesis. Biol Reprod 2005 73:1157-1163[Abstract/Free Full Text]
  25. Allsopp R, Cheshier S, Weissman I, Telomere shortening accompanies increased cell cycle activity during serial transplantation of hematopoietic stem cells. J Exp Med 2001 193:917-924[Abstract/Free Full Text]
  26. Cheshier SH, Morrison SJ, Liao X, Weissman IL, In vivo proliferation and cell cycle kinetics of long-term self-renewing hematopoietic stem cells. Proc Natl Acad Sci U S A 1999 96:3120-3125[Abstract/Free Full Text]
  27. Blasco MA, Funk W, Villeponteau B, Greider CW, Functional characterization and developmental regulation of mouse telomerase RNA. Science 1995 269:1267-1270[Abstract/Free Full Text]
  28. Liu K, Hodes RJ, Weng NP, Cutting edge: telomerase activation in human T lymphocytes does not require increase in telomerase reverse transcriptase (hTERT) protein but is associated with hTERT phosphorylation and nuclear translocation. J Immunol 2001 166:4826-4830[Abstract/Free Full Text]
  29. Seimiya H, Sawada H, Muramatsu Y, Shimizu M, Ohko K, Yamane K, Tsuruo T, Involvement of 14-3-3 proteins in nuclear localization of telomerase. EMBO J 2000 19:2652-2661[CrossRef][Medline]
  30. Allsopp RC, Chang E, Kashefi-Aazam M, Rogaev EI, Piatyszek MA, Shay JW, Harley CB, Telomere shortening is associated with cell division in vitro and in vivo. Exp Cell Res 1995 220:194-200[CrossRef][Medline]
  31. Masutomi K, Yu EY, Khurts S, Ben-Porath I, Currier JL, Metz GB, Brooks MW, Kaneko S, Murakami S, DeCaprio JA, Weinberg RA, Stewart SA, Hahn WC, Telomerase maintains telomere structure in normal human cells. Cell 2003 114:241-253[CrossRef][Medline]
  32. Stewart SA, Hahn WC, O'Connor BF, Banner EN, Lundberg AS, Modha P, Mizuno H, Brooks MW, Fleming M, Zimonjic DB, Popescu NC, Weinberg RA, Telomerase contributes to tumorigenesis by a telomere length-independent mechanism. Proc Natl Acad Sci U S A 2002 99:12606-12611[Abstract/Free Full Text]
  33. Masutomi K, Possemato R, Wong JM, Currier JL, Tothova Z, Manola JB, Ganesan S, Lansdorp PM, Collins K, Hahn WC, The telomerase reverse transcriptase regulates chromatin state and DNA damage responses. Proc Natl Acad Sci U S A 2005 102:8222-8227[Abstract/Free Full Text]
  34. Zhu H, Fu W, Mattson MP, The catalytic subunit of telomerase protects neurons against amyloid beta-peptide-induced apoptosis. J Neurochem 2000 75:117-124[CrossRef][Medline]
  35. Kipling D, Cooke H, Hypervariable ultra-long telomeres in mice. Nature 1990 347:400-402[CrossRef][Medline]
  36. Erdmann N, Liu Y, Harrington L, Distinct dosage requirements for the maintenance of long and short telomeres in Tert heterozygous mice. Proc Natl Acad Sci U S A 2004 101:6080-6085[Abstract/Free Full Text]
  37. Allsopp RC, Morin GB, Horner JW, DePinho R, Harley CB, Weissman IL, Effect of TERT over-expression on the long-term transplantation capacity of hematopoietic stem cells. Nat Med 2003 9:369-371[CrossRef][Medline]
  38. Artandi SE, Alson S, Tietze MK, Sharpless NE, Ye S, Greenberg RA, Castrillon DH, Horner JW, Weiler SR, Carrasco RD, DePinho RA, Constitutive telomerase expression promotes mammary carcinomas in aging mice. Proc Natl Acad Sci U S A 2002 99:8191-8196[Abstract/Free Full Text]
  39. Wang J, Xie LY, Allan S, Beach D, Hannon GJ, Myc activates telomerase. Genes Dev 1998 12:1769-1774[Abstract/Free Full Text]
  40. Lin SY, Elledge SJ, Multiple tumor suppressor pathways negatively regulate telomerase. Cell 2003 113:881-889[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
75/5/785    most recent
biolreprod.106.052167v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Coussens, M.
Right arrow Articles by Allsopp, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coussens, M.
Right arrow Articles by Allsopp, R.
Agricola
Right arrow Articles by Coussens, M.
Right arrow Articles by Allsopp, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS