|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
Department of Obstetrics and Gynecology, College of Medicine, University of Illinois at Chicago, Chicago, Illinois, 60612
ABSTRACT
Endometriosis, the presence of a functional endometrium outside of the uterine cavity, is associated with infertility. In our simulated model of pregnancy in baboons with experimental endometriosis, hCG infusion fails to induce expression of the immunoregulatory protein glycodelin. To test the hypothesis that the development of endometriosis is associated with an aberrant endometrial immunological environment, we examined the expression of a series of immunoregulatory genes in endometrium from baboons with and without endometriosis. Six months following intraperitoneal inoculation with menstrual endometrium, eutopic endometrium was surgically collected between Days 9 and 11 postovulation. Control endometrium was similarly collected from disease-free animals. Total RNA was extracted, and biotinylated cDNA probes were hybridized to the SuperArray GEArray Q series Th1/Th2/Th3 cDNA array, representing 96 genes. Gene expression levels were determined using ScanAlyze and GEArray Analyzer software. Seven genes were upregulated, including JUND, FOS, CCL11, NFKB1 and others, in the endometrium from baboons with endometriosis compared with the endometrium from disease-free animals; one gene, IL1R1, was downregulated. Quantitative RT-PCR confirmed upregulation of FOS and CCL11 in endometriotic eutopic endometrium. Immunohistochemical analysis revealed altered levels and distribution of FOS protein in the eutopic endometrium of baboons with induced endometriosis. These data suggest that in an induced model of endometriosis an aberrant eutopic immunological environment results in a decreased apoptotic potential and in rapid alterations in endometrial gene expression. We propose that the reduced fecundity associated with endometriosis has a multifold etiology in spontaneous and induced disease.
cytokines, gene regulation, immunology, steroid hormone receptors, uterus
INTRODUCTION
Endometriosis, the presence of a functional endometrium outside of the uterine cavity, is one of the most common causes of chronic pelvic pain and is associated with infertility; it affects 1 in 10 women in the reproductive age group [1, 2]. This incidence increases up to 30% in patients with infertility [3]. Multiple factors have been implicated in endometriosis-associated infertility, including distortion of the pelvic anatomy, abnormalities of hormone secretion, alterations in peritoneal fluid, disorders of fertilization, and immunoregulatory dysfunction [47]. Although histologically normal, examination of eutopic endometrium from women with endometriosis has revealed defects, including aberrant levels of angiogenic factors (such as vascular endothelial growth factor [VEGF] and CYR61), ultrastructural abnormalities, and alterations in molecular markers of endometrial receptivity; specifically,
vß3 integrin distribution patterns and HOXA10 gene expression are aberrant in the endometrium of women with endometriosis [816]. Furthermore, it has been shown that some of these markers are also altered in baboons with induced disease [17, 18]. The steroid hormone receptor profile in eutopic endometrium is also dysregulated in spontaneous and induced disease in humans and baboons [1922]. Specifically, diminished progesterone receptor A (PGR-A) immunostaining of glandular epithelial cells in eutopic endometria from animals with induced disease compared with control tissues has been demonstrated and suggests that, in the absence of epithelial PGR-A, estrogen-regulated genes (including VEGF and CYR61) are no longer subjected to progesterone-mediated suppression, creating a uterine environment that is not conducive to the establishment of pregnancy [17].
Microarray analysis of human endometrium obtained during the window of receptivity has shown a 50-fold decrease in the mRNA levels of the progesterone-regulated immunosuppressive molecule glycodelin A, also known as progestagen-associated endometrial protein (PAEP), in women with endometriosis compared with those without endometriosis [22]. Furthermore, in eutopic endometrium, hCG failed to induce PAEP protein production in an in vivo simulated model of pregnancy in baboons with endometriosis [23]. Antagonism of progesterone with PGR antagonists in disease-free baboons treated with hCG shows a similar response, suggesting that progesterone and its receptor mediate immunosuppressive events thought to be critical in the protection of the embryo from maternal immune rejection [24, 25].
We propose that the infertility associated with endometriosis is due, in part, to a resistance to progesterone and a subsequent hyperresponsiveness to estrogen (E2); furthermore, we propose that a lack of progesterone-mediated immunoregulation leads to an aberrant immunological endometrial environment in animals with endometriosis. In this study, we used a focused cDNA microarray to determine if immunological aberrations were evident in the eutopic endometrium in our baboon model of experimentally induced endometriosis.
MATERIALS AND METHODS
Induction of Endometriosis
Endometriosis was experimentally induced in female Papio anubis baboons with documented regular menstrual cycles who had not undergone previous surgical intervention, by means of intraperitoneal inoculation with menstrual endometrium in two consecutive menstrual cycles, as previously described [23, 26]. Menstrual endometrium (0.84 ± 0.22 g) was harvested on Day 2 of menstruation using a Unimar Pipelle (Cooper Surgical) just before laparoscopy. The peritoneal cavity and reproductive organs were visualized by laparoscopy, and the absence of any lesions or adhesions was documented by video recording. Under laparoscopic guidance, menstrual tissue was deposited from the Pipelle at four sites: the pouch of Douglas, the uterine fundus, the cul de sac, and the ovaries. At the subsequent menses, the animals underwent a second laparoscopy and endometrial reseeding at the same ectopic sites. The progression of disease was monitored in each animal by consecutive laparoscopies and video recording at 3, 6 to 7, 9 to 10, 12, and 15 to 16 mo after inoculation during the window of uterine receptivity (Days 911 postovulation [PO] in the baboon). At the time of laparoscopy, the number, color (red, blue, chocolate, white, or mixed pigmentation), and position of each visible lesion was documented by video recording. The presence of peritoneal fluid (clear or bloody), extent of peritoneal adhesions, level of surface vasculature on the peritoneal wall and organs, scar tissue, and corpus luteum were noted. Following each laparoscopy, a laparotomy was performed in which ectopic endometriotic lesions and matched eutopic endometrium was harvested by endometriectomy. Intraperitoneal inoculation resulted in the formation of red, blue, chocolate, and white lesions with gross morphological and histological characteristics similar to those seen in women, as previously described [23, 26]. The number and type of lesions ranged among animals, but on average we observed three red, three blue, two chocolate, one white, and two mixed-pigmentation lesions during each laparoscopy. All experimental procedures were approved by the Animal Care Committee of the University of Illinois at Chicago.
Collection and Processing of Tissue
Blood samples were collected daily from Days 7 through 16 postmenstruation (where Day 1 was the first day of menstruation) in menstrual cycles during which surgery was to be performed. Serum E2 was measured by radioimmunoassay (DSLabs, Webster, TX). The serum E2 peak was designated as Day 1 of ovulation, and the day of ovulation was designated as Day 1. Tissues were harvested between Days 9 and 11 PO, which corresponds to the approximate time of implantation in the baboon. All laparoscopies and laparotomies were performed during the window of uterine receptivity. Harvested eutopic and ectopic endometria were snap frozen in liquid nitrogen for RNA extraction or were fixed in 10% buffered formalin for 24 h at room temperature for immunohistochemical and morphological analysis. Morphologically, 32 (67%) of 48 ectopic lesions harvested contained endometrial glands and stroma. Control endometrium was similarly harvested from animals without disease at Days 9 through 11 PO or during the late proliferative phase of the cycle. Although control animals did not undergo multiple laparoscopies, they were subjected to laparotomies. Two disease-free control animals had two previous surgical procedures, three animals had three previous procedures, and one animal had four previous procedures.
Gene Array
Eutopic endometria harvested from three animals with experimental endometriosis at six months of disease and from three healthy control animals were homogenized in TRIZOL reagent (Invitrogen Corp., Carlsbad, CA). Total RNA was purified with chloroform/isoamyl alcohol. RNA was evaluated by electrophoresis before continuing with probe synthesis and hybridization. Total RNA (3 µg) was reverse transcribed, and double-stranded cDNA probes were generated by biotin-16-dUTP incorporation using the AmpoLabeling-LPR Kit (SuperArray, Frederick, MD), according to the manufacturer's instructions. The cDNA probes were denatured at 95°C for 2 minutes. Th1/Th2/Th3 array membranes (SuperArray) were prehybridized in GEAprehyb (SuperArray) with heat-denatured sheared salmon sperm for 2 h at 60°C. Labeled cDNA probes were hybridized overnight at 60°C with continuous agitation. Following repetitive washing in saline-sodium citrate/SDS, hybridized cDNA probes were detected by chemiluminescence. Membranes were blocked for nonspecific binding with GEAblocking solution Q (SuperArray). Bound biotinylated cDNA probe was detected with alkaline phosphatase-conjugated streptavidin and CDP-Star chemiluminescent substrate (SuperArray). Images of the membranes were recorded on x-ray film and were digitally recorded on a personal densitometer scanner (Molecular Dynamics, Sunnyvale, CA). Tetra-spots were converted into numerical data using ScanAlyze software (http://rana.lbl.gov/EisenSoftware.htm). Data were further processed with GEArray Analyzer software (http://www.superarray.com, correcting for background noise by subtraction of the minimum value and normalizing to the maximum value of each individual array. Genes were considered present if the expression level was greater than two times that of the blank negative control. Genes were considered to be differentially expressed in control and endometriotic endometria if the change was less than 0.5-fold or greater than 2.0-fold and two of the three samples followed the upregulation or downregulation.
Quantitative RT-PCR
Total RNA was prepared, as already noted, from the same endometriotic animals across the course of disease progression at 3 mo (n = 3), 6 mo (n = 4), 9 mo (n = 2), 12 mo (n = 2), and 15 mo (n = 4) of endometriosis and from control animals (n = 4). Total RNA (1 µg) was reverse transcribed with M-MLV reverse transcriptase (20 IU, Invitrogen) and random primers (0.3 µg, Invitrogen). The absolute expression of selected genes was compared in endometria across different stages of disease and controls by performing quantitative RT-PCR with an ABI PRISM 7700 sequence detection system (TaqMan) according to the manufacturer's instructions (Applied Biosystems, Foster City, CA). CCL11, FOS, and YY1 mRNAs were detected with primers and probes from Assays on Demand (Applied Biosystems). Values were normalized against those for the H3F3A mRNA to control for differing amounts of starting material. Primers and probes for H3F3A (NM_002107) were designed using PRIMER EXPRESS version 2.0.0 software (Applied Biosystems): GGCGCTCCGTGAAATTAGAC (forward primer), CGCTGGAAGGGAAGTTTGC (reverse primer), and TTATCAGAAGTCCACTGAACTTCTGATT (probe). The H3F3A probe was labeled with 5'FAM and 3'TAMRA. All primers and probes were designed such that the amplicons spanned intron-exon boundaries. Standard curves were generated for each gene by serial dilution of the amplicon isolated from a control RT-PCR product by electrophoresis. The level of RT-PCR product was presented as a ratio of the absolute quantity of RNA of the gene of interest to the absolute quantity of H3F3A RNA present.
Immunohistochemistry
Formalin-fixed tissues were embedded in paraffin. Formalin-fixed paraffin-embedded 5-µm sections of eutopic endometrium were examined for the immunolocalization of FOS protein. Following antigen retrieval with Antigen Unmasking Solution (catalog number H-3300; Vector Laboratories Inc., Burlingame, CA) and a Decloaking Chamber electric pressure cooker (Biocare Medical, Walnut Creek, CA), endogenous peroxidase activity was blocked with 0.3% H2O2. After blocking with 3% normal rabbit serum in Tris-buffered saline (TBS), sections were incubated in rabbit anti-human FOS (1:100; Calbiochem, San Diego, CA) in TBS/3% normal goat serum overnight at 4°C. Immunostaining was developed with the Vector ABC Elite Peroxidase Vectastain kit (Vector Laboratories Inc.) and diaminobenzidine [27]. Sections were counterstained with Gill hematoxylin, dehydrated, and mounted with Permount (Fisher Scientific). Subsequent sections were stained with Gomori trichrome [28]. Stained sections were examined on a Nikon ECLIPSE E400 microscope and were documented using SPOT Advanced version 4.0.1 software (Diagnostic Instruments, Inc., Sterling Heights, MI).
Statistical Analysis
Nonparametric statistical analysis was performed on quantitative mRNA expression levels of YY1, FOS, and CCL11 measured in eutopic endometrial tissues from control baboons and from baboons with six months of disease using one-tailed Mann-Whitney U-test. Nonparametric ANOVA was performed on quantitative mRNA expression levels of FOS in endometriotic endometrium from animals across the disease time course using Kruskal-Wallis one-way ANOVA and Dunn multiple comparisons test. Analysis was carried out using InStat (GraphPad Software Inc., San Diego, CA). P < 0.05 was considered statistically significant.
RESULTS
Immunological Gene Expression of Baboon Endometrium
Ninety-six genes were represented in the GEArray Th1/Th2/Th3 Pathway Gene Array. Fifteen and twenty-one of these genes were found to be expressed in the eutopic endometrium of control and endometriotic baboons, respectively (Table 1). Eight genes were differentially expressed in the eutopic endometrium of endometriotic animals compared with that of disease-free animals: one gene was downregulated, and seven genes were upregulated (Table 2). Interleukin 1 receptor type 1 (IL1R1) mRNA was reduced 0.2-fold in the endometriotic samples compared with the control samples. The highest upregulation was seen in JUND with a 7.9-fold increase in mRNA levels in endometriotic vs. control endometrium: a second member of the activating protein 1 (AP-1) family of transcription factors was upregulated, namely, the E2 early response gene FOS. Chemokine receptor CCR9 and eosinophil chemoattractant CCL11 mRNAs were upregulated 2.3-fold in the eutopic endometrium of baboons with endometriosis compared with that of disease-free animals. The transcription factor nuclear factor of
polypeptide gene enhancer in B cells (NFKB1) and the zinc finger protein 144 (PCGF2) were upregulated in endometrium from baboons with endometriosis compared with control animals. ACTB mRNA levels were higher in the endometrium from animals with disease, with a 4.5-fold change over the control endometrium; however, this increase could not be verified by quantitative RT-PCR (data not shown).
|
|
Ten genes were similarly expressed in endometrium from control and endometriotic animals (Table 1). These include glyceraldehyde-3-phosphate dehydrogenase (GAPDH), cyclophilin (PP1A), transcription factor YY1, and three members of the AP-1 family (ATF2, JUN, and mitogen-activated protein kinase 9 [MAPK9], also known as c-jun aminoterminal kinase 2 [JNK2]).
Array Verification
The transcription factor YY1 showed similar mRNA expression levels in control and diseased tissues. This was verified by quantitative RT-PCR with the same samples used for the array plus one additional endometriotic and one additional control RNA sample (P > 0.05) (Fig. 1a). Furthermore, we verified that CCL11 and FOS mRNAs were significantly upregulated in eutopic endometrium from baboons experimentally induced with endometriosis, with 26-fold and 10-fold changes, respectively, over control samples (P < 0.05, one-tailed Mann-Whitney U-test) (Fig. 1).
|
FOS mRNA Is Differentially Expressed Through Progression of Disease
FOS, an E2 early response gene, is a member of the AP-1 family of transcription factors. We propose that the increased levels of FOS mRNA demonstrated herein in the eutopic endometrium of baboons experimentally induced with endometriosis may be mediated by the hyperestrogenic responsiveness that is associated with this disease. FOS may mediate aberrant expression of other genes. Therefore, the endometrial expression of FOS mRNA was determined by quantitative RT-PCR at each time point during the development of endometriosis. Endometrial samples were progressively harvested from the same animals at 3, 6, 9, 12, and 15 mo of disease. FOS mRNA was differentially expressed throughout the progression of endometriosis. Maximal FOS mRNA expression was seen at three months of disease, with a 483-fold upregulation over control samples (P < 0.05, Kruskal-Wallis ANOVA with Dunn correction for multiple testing) (Fig. 2). FOS mRNA gradually decreased throughout the progression of disease, to 93-fold and 60-fold increases over control levels at 6 and 12 mo of disease, respectively. Fifteen months after induction of disease, the levels of FOS mRNA expression were almost the same as those found in control tissues from animals without disease, with only a 5-fold increase over control levels.
|
FOS Protein Is Differentially Distributed in Endometriosis
FOS protein was immunolocalized in stromal, epithelial, and endothelial cells of normal proliferative and secretory endometrium (Fig. 3, A, B, E, and F). During the late proliferative phase of the menstrual cycle, FOS protein was localized at the perimeter of the nucleus in epithelial and stromal cells (Fig. 3, A and E). FOS protein was immunolocalized in the nucleus in epithelial and stromal cells during the secretory phase of the menstrual cycle (Fig. 3, B and F). While all epithelial cells remained immunopositive under the progestogenic conditions of the secretory endometrium, the level of staining within the stromal compartment was reduced. Increased levels of FOS protein were present in the eutopic endometrium of animals at six months following induction of endometriosis compared with controls (Fig. 3, C and G). Moreover, FOS was differentially distributed between the epithelial and stromal cells of endometriotic endometrium. Epithelial FOS protein was primarily localized in the nucleus of epithelial cells, although immunostaining was also found in the cytoplasm. While nuclear staining was evident in the majority of stromal cells within endometriotic endometrium, FOS was immunolocalized to the nuclear membrane in some stromal cells (Fig. 3G). The intensity of the FOS staining was less in tissues from animals at 15 mo of disease, and the pattern of the FOS distribution was primarily nuclear, although epithelial cells demonstrated low levels of cytoplasmic immunostaining (Fig. 3, D and H). Therefore, the distribution of FOS in tissues from animals at 15 mo of disease resembled that seen in control secretory endometrium (Fig. 3, B and D). Consequently, the level of FOS protein present in control and endometriotic endometria parallels that of FOS mRNA levels in the same samples.
|
DISCUSSION
Endometriosis is associated with a reduction in fecundity. In the baboon model of experimental endometriosis, it was previously demonstrated that the eutopic endometrium responds inappropriately to embryonic signals [23]. Specifically, hCG infusion fails to induce the epithelial production of the immunomodulatory protein PAEP and stromal production of
-smooth muscle actin required for stromal cell decidualization [23]. We proposed that these changes result in an aberrant uterine environment that is not conducive to the establishment of pregnancy. Using the nonhuman primate model of experimental endometriosis, we examined the expression of immunoregulatory genes during the window of uterine receptivity using a focused cDNA microarray.
Eight of the 96 genes represented in the GEArray Th1/Th2/Th3 Pathway Gene Array were differentially expressed in eutopic endometrium from baboons experimentally induced with endometriosis compared with that from control disease-free animals: IL1R1 mRNA levels were downregulated, while JUND, PCGF2, NFKB1, CCR9, CCL11, and FOS were upregulated. PCGF2 mRNA expression was very close to the lower limit of detection of the assay; furthermore, it has not been previously identified in endometrium, to our knowledge. The chemokine receptor CCR9 also, to our knowledge, has not been identified in endometrium. Therefore, PCGF2 and CCR9 were excluded from further analysis. Endometrial expression of the AP-1 family members JUND and FOS, the transcription factor NFKB1, CCL11, and IL1R1 have previously been demonstrated; furthermore, the expression of these genes has been shown to be hormonally regulated [2933]. Additional analysis was focused on NFKB1, CCL11, IL1R1, and members of the AP-1 family of transcription factors.
Two members of the AP-1 family were upregulated in the eutopic endometrium of baboons with endometriosis, namely, FOS and JUND. The AP-1 family is a menagerie of dimeric proteins that play a critical role in controlling cell life and death [34]. It is well established that FOS is induced by E2, and it is thought that this induction plays a critical role in E2-mediated proliferation of endometrial cells [3537]. Kirkland et al. [38] demonstrated inhibition of E2-induced FOS by medroxyprogesterone acetate, suggesting that progesterone-mediated inhibition of endometrial cell proliferation during the secretory phase of the menstrual cycle is mediated by inhibition of c-fos. Indeed, AP-1 proteins, including FOS, are cyclically controlled in human and rodent endometrium, with maximal levels seen under estrogenic conditions in the proliferative and metestrus/diestrus stages of the cycle [2931]. Furthermore, FOS has been shown to inhibit the transcriptional activity of PGR [39], suggesting that it may be involved in gene repression. Indeed, transformation of rat fibroblasts with FOS induces the expression of DNA 5-methylcytosine transferase (DNMT1), which causes hypermethylation and subsequent repression of gene expression [40, 41]. AP-1 sites have been identified in the DNMT1 gene, and abrogation of FOS expression decreases the level of DNMT1 mRNA [39, 42]. Downregulation of several progesterone-regulated genes has been previously identified in human spontaneous and nonhuman primate-induced endometriosis, including the
vß3 integrin, PGR, and HOXA10 [1117]. Wu et al. [43] recently demonstrated that the reduction of HOXA10 mRNA and protein seen in women with endometriosis was associated with hypermethylation of the HOXA10 gene. We propose that the upregulation of FOS in the eutopic endometrium of baboons with endometriosis is mediated by enhanced activation of estrogen receptor 1, which is no longer suppressed by PGR-A-mediated events, and that these increased levels of FOS may promote aberrant endometrial proliferation during the window of implantation. In addition, increased FOS may induce the expression of DNMT1 and subsequent hypermethylation and downregulation of endometrial HOXA10 and other progesterone-regulated genes critical to the establishment of pregnancy. Gonadotropin-releasing hormone, analogues of which are commonly used clinically to treat endometriosis, decreases the expression of FOS in endometrial stromal and epithelial cells in vitro [44].
The profile of steroid hormone receptor (SHR) distribution throughout the time course of our disease model does not parallel that of FOS expression [17]: aberrant expression of SHRs was not observed in our endometriotic baboons until six months after disease induction, while maximal upregulation of FOS mRNA is demonstrated herein at three months of disease. Nongenomic effects of E2 have been identified in many mammalian tissues [45, 46]. Moreover, results of breast carcinoma cell studies suggest that E2-induced expression of FOS mRNA can occur through G protein-coupled receptors and MAPK and PI3K intracellular signaling cascades [4749]. Therefore, increased levels of FOS mRNA seen in the eutopic endometrium of animals in the early stages of the development of endometriosis may be mediated, in part, through nongenomic actions of E2.
CCL11 showed a 2.3-fold upregulation in mRNA expression in endometriosis. There are conflicting data on the localization of CCL11 in the endometrium; however, increased levels of CCL11 protein have been demonstrated in the epithelium of endometriotic lesions [33, 50, 51]. CCL11 stimulates angiogenic activity in human, mouse, rat, and chick endothelial cells [52]. Zhang et al. [51] demonstrated the presence of CCL11 in endometrial perivascular cells. More recently, women treated with the progestin-only contraceptive pill, which is associated with breakthrough bleeding, have shown increased levels of endometrial CCL11 [53]. We propose that the increased levels of CCL11 demonstrated in baboons with endometriosis may mediate abnormal endometrial angiogenesis. Increased levels of angiogenesis are well documented in women with endometriosis [8, 54]. Furthermore, increased expression of two other angiogenic factors, CYR61 and VEGF, was previously shown in the endometrium of baboons with induced endometriosis [18]. Increased levels of CCL11 in the endometrium of baboons with induced endometriosis, together with CYR61 and VEGF, may increase the angiogenic potential of the tissue.
The transcription factor NFKB1 was upregulated 3.0-fold in the eutopic endometrium of baboons induced with endometriosis. Progesterone controls endometrial development, in part, via suppression of the NFKB pathway [55, 56]. Reduced levels of PGR-A, as already described, may lead to increased levels of NFKB1 transcription and activity, resulting in an inflammatory and proliferative endometrium during the window of uterine receptivity. Indeed, eutopic endometrium in women with endometriosis appears to be resistant to apoptosis and shows aberrant expression of genes in this pathway [5759].
IL1R1 showed a 5-fold decrease in the eutopic endometrium of baboons induced with endometriosis. Investigations in the rodent have shown that intraperitoneal injection of IL-1 receptor antagonist prevents implantation by perturbations in epithelial cell integrin expression [60]. Aberrant integrin distribution has been demonstrated in the eutopic endometrium of women with endometriosis [11]. Reduction in IL1R1 in the eutopic endometrium of baboons with induced endometriosis may mediate aberrant expression of
vß3. In addition, it has been shown that antagonism of IL-1ß in the simulated model of pregnancy in the baboon suppresses hCG-induced morphological transformation of the endometrium, suggesting that IL-1R, in part, mediates endometrial responses to embryonic signals [61].
In summary, we present evidence of the dysregulation of multiple factors in the eutopic endometrium of baboons with experimental endometriosis. We believe this is the first time that many of these genes have been shown to be differentially expressed in endometriosis. We also show that these changes occur very early in the development of the disease, within three months of inoculation with menstrual endometrium. Therefore, the nonhuman primate model of endometriosis will allow the investigation of whether functional changes are altered as a result or as a cause of this disease.
In conclusion, these data suggest that, in an induced model of endometriosis in the nonhuman primate, aberrant levels of SHRs, resulting in progesterone resistance and subsequent estrogen hyperresponsiveness, create an endometrium in which decreased apoptotic potential, increased angiogenic ability, aberrant immunological environments, and defective responses to embryonic signals are rapidly observed. We propose that the reduced fecundity associated with endometriosis has a multifold etiology in spontaneous and induced disease. Furthermore, the baboon model of experimental endometriosis shows changes similar to those observed in spontaneous disease. This provides a powerful model to understand the early events associated with the pathophysiology of endometriosis and its associated infertility.
FOOTNOTES
1 Supported by award U54 HD40093 from the National Institute of Child Health and Human Development Specialized Cooperative Centers Program in Research in Reproduction to A.T.F. and by a National Institutes of Health minority supplement to K.S.J. ![]()
2 Correspondence: Asgerally T. Fazleabas, Department of Obstetrics and Gynecology, College of Medicine, University of Illinois at Chicago, MC808, 820 S Wood Street, Chicago, IL 60612. FAX: 312 996 8329; asgi{at}uic.edu ![]()
Received: 29 March 2006.
First decision: 20 April 2006.
Accepted: 30 April 2006.
REFERENCES
vß3 in women with and without endometriosis. Hum Reprod 1998 13:1030-1035
-smooth muscle actin expression in the baboon (Papio anubis) uterus is associated with glandular secretory activity and stromal cell transformation. Biol Reprod 1995 53:598-608[Abstract]
B pathway in human endometrium and first trimester decidua. Mol Hum Reprod 2001 7:175-183
B inactivation by progesterone through progesterone receptors in Hec50co poorly differentiated endometrial cancer cells: induction of A20 and ABIN-2. Gynecol Oncol 2004 94:463-470[CrossRef][Medline]This article has been cited by other articles:
![]() |
J. D. Wren, Y. Wu, and S.-W. Guo A system-wide analysis of differentially expressed genes in ectopic and eutopic endometrium Hum. Reprod., August 1, 2007; 22(8): 2093 - 2102. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, C. Zhu, H. Lin, Q. Yang, Q. Ou, Y. Li, Z. Chen, P. Racey, S. Zhang, and H. Wang Wild Fulvous Fruit Bats (Rousettus leschenaulti) Exhibit Human-Like Menstrual Cycle Biol Reprod, August 1, 2007; 77(2): 358 - 364. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.J. Kim, H.S. Taylor, Z. Lu, O. Ladhani, J.M. Hastings, K.S. Jackson, Y. Wu, S.W. Guo, and A.T. Fazleabas Altered expression of HOXA10 in endometriosis: potential role in decidualization Mol. Hum. Reprod., May 1, 2007; 13(5): 323 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.J.P. Jones, J. Denton, and A.T. Fazleabas Morphological and glycosylation changes associated with the endometrium and ectopic lesions in a baboon model of endometriosis Hum. Reprod., December 1, 2006; 21(12): 3068 - 3080. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |