Biol Reprod Lalor Postdoctoral Fellowships -- Application Deadline January 15, 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print December 7, 2005.
Biol Reprod 2005, 10.1095/biolreprod.105.045096
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/3/577    most recent
biolreprod.105.045096v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ponsuksili, S.
Right arrow Articles by Schwerin, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ponsuksili, S.
Right arrow Articles by Schwerin, M.
Agricola
Right arrow Articles by Ponsuksili, S.
Right arrow Articles by Schwerin, M.
BIOLOGY OF REPRODUCTION 74, 577–584 (2006)
DOI: 10.1095/biolreprod.105.045096
© 2006 by the Society for the Study of Reproduction, Inc.


Research Article

Bovine NALP5, NALP8, and NALP9 Genes: Assignment to a QTL Region and the Expression in Adult Tissues, Oocytes, and Preimplantation Embryos

Siriluck Ponsuksili 2, Ronald M. Brunner 1 3, Tom Goldammer 3, Christa Kühn 3, Christina Walz 2, Siriwadee Chomdej 4, Dawit Tesfaye 4, Karl Schellander 4, Klaus Wimmers 3, and Manfred Schwerin 2

Research Group Functional Genomics2 and Research Unit Molecular Biology,3 Research Institute for the Biology of Farm Animals (FBN), 18196 Dummerstorf, Germany Institute of Animal Science,4 Animal Breeding and Husbandry Group, University of Bonn, 53115 Bonn, Germany

ABSTRACT

A 3204-bp full-length cDNA of bovine NALP9 was cloned and its genomic organization was analyzed. The 2988-bp open reading frame covers 9 exons and encodes a deduced protein of 996 amino acids containing Pyrin, Nacht and leucine-rich repeat domains like the human NALP gene family members. Mapping with the WGRH5000 panel and fluorescence in situ hybridization assigned NALP9 in close vicinity to BM2078 (LOD score 25.71; distance 0.0 cR5000) on bovine chromosome 18, BTA18q25-q26, within a previously identified QTL region for reproductive traits flanked by the bovine marker BM2078 and TGLA227. BAC contig analysis revealed that NALP9, NALP8, and NALP5 map in this QTL region. Temporospatial expression of these members of the NALP gene family was monitored. Among the adult tissues examined, transcripts of NALP8 and NALP9 were detected exclusively in testis and ovary, whereas transcripts of the NALP5 gene are limited to the ovary. The transcripts of NALP9, NALP8, and NALP5 were detected in oocytes before and after in vitro maturation and with a gradual decline from 2-cell to 8-cell stage, suggesting no reactivation at the time of bovine maternal to embryonic transition. Assignment to a QTL region for reproductive traits and preferential expression of NALP9, NALP8, and NALP5 in oocyte, germinal lineage, and gonad cells may suggest their functional relevance to reproduction and possible contribution to phenotypic variation.

early development, oocyte development, ovary, testis

INTRODUCTION

Members of the NALP gene family are important for gametogenesis, folliculogenesis, and early embryonic development. The NALP family proteins exhibit the following tripartite structure: PYD-NACHT-LRR. The PYD domain was identified as a putative protein-protein interaction domain at the N-terminal region of several proteins that are thought to function in apoptotic and inflammatory signaling pathways [1]. NACHT domains are found in a specific family of nucleoside triphosphatases [2]. LRRs (leucine-rich repeats) are 20–29-residue sequence motifs present in tandem arrays in a number of proteins with diverse functions [3]. Expression profiles of NALP genes imply their functional relevance in reproduction. NALP5 displays oocyte-restricted expression in mouse, human, and cattle [46]. Nalp5 exhibits maternal effects, with null female mice being sterile. The development of embryos of Nalp5-null females is arrested at the 2-cell stage [4]. Nalp5 and three other Nalp genes (Nalp9a, Nalp14, and Nalp4b) show decreased expression in the oocyte during maternal aging in mouse [7]. Nalp9a, Nalp9c, Nalp9e, and Nalp9f appeared to be exclusively expressed in the ovary, whereas Nalp9d shows expression in both ovary and testis, in mouse [8]. Bovine quantitative trait loci (QTL) for reproductive traits (stillbirth, a binary trait with calves being either dead or alive 24 h postpartum; nonreturn rate of 90 days, percentage of cows that do not return to service within 90 days of first insemination) have been identified on the telomere of chromosome 18 between markers BM2078 and TGLA227 [9]. This region corresponds to orthologous regions on the mouse and human chromosomes that contain the NALP genes, 77 cM on chromosome 7 and cytogenetic band q43 on chromosome 19, respectively. Thus, within this QTL region, NALP genes represent candidate genes for reproductive traits.

In this study we characterize the bovine NALP9 gene as well as its vicinity representing a QTL region for reproduction traits. Moreover, expressions of NALP9, NALP8, and NALP5 were monitored in somatic gonadal tissue as well as along oocyte to preimplantation embryo development.

MATERIALS AND METHODS

Oocyte Collection and Embryo Production

Bovine embryos were produced in vitro from oocytes obtained from ovaries collected from a local abattoir and transported to the laboratory within 3 h in a thermos flask containing saline at 30°C. After two washes in fresh saline, cumulus oocyte complexes (COCs) were aspirated from antral follicles of 2–8 mm diameter. COCs with a homogenous, evenly granulated ooplasm surrounded by at least three layers of compact cumulus cells were collected into modified Tissue Culture Medium 199 (TCM199; Sigma) supplemented with 4.43 mM Hepes, 33.9 mM NaHCO3, 2 mM pyruvate, 2.92 mM calcium lactate, 55 µg/ml gentamicin, and 15% heat-inactivated estrus cow serum. After three wash steps, COCs in groups of 50 were matured in vitro for 24 h at 39°C in a humified atmosphere with 5% CO2 in air in 400 µl of the above-described modified TCM supplemented with 10 µg/ml FSH (FSH-p; Schering) and covered with paraffin oil. After maturation, the oocytes were inseminated with swim-up-separated frozen-thawed semen from a known bull in 400 µl Fert-TALP [10] supplemented with 20 µM penicillamin (Sigma), 10 µM hypotaurin (Sigma), 2 µM epinephrine (Sigma), 6 mg/ml BSA, and 50 µg/ml gentamicin. Final concentration of spermatozoa in the fertilization drop was adjusted to 1 x 106 spermatozoa/ml. After 18 h of coculture, oocytes, spermatozoa, and presumptive zygotes were denuded by repetitive pipeting using glass pipettes and transferred to 400 µl CR1aa culture medium [11]. Embryos were cultured at 39°C in a humified atmosphere with 5% CO2 in air until Day 7 blastocyst stage. Classification and selection of oocytes and embryos for RNA preparation was done according to the following characteristics: Unfertilized oocytes (24 h maturation), two-, four-, and eight-cell-stage embryos (36, 48 and 64 h postinsemination), morula (120 h postinsemination), and blastocyst (168 h postinsemination). All embryos were washed carefully three times in PBS, collected in 0.5 µl of PBS and 1.5 µl lysis buffer (0.8% Igepal [Sigma] and 1 U/µl RNasin [Promega] with 5 mM DTT [Promega]) and finally snap-frozen in liquid nitrogen before storage at –70°C for further use. The experiments described in this study were performed in accordance with all appropriate regulations regarding care and use of research animals and were approved by the authors' institutional animal care and use committee.

RNA Isolation from Organ Biopsies, Oocyte, Embryos, cDNA Synthesis, and PCR Amplification of NALP Genes

RNA was isolated from nine tissues (uterus, adrenal gland, intestine lymphocytes, leukocytes, pituitary gland, liver, mammary gland, testis, and ovary) using TRI Reagent (Sigma) according to the manufacturer's protocol. After DNase treatment, RNA was quantified and integrity-checked by electrophoresis of 1 µg on 1% agarose gels containing formaldehyde stained with ethidium bromide. RNAs and corresponding cDNAs were used as templates in PCR reactions using intron spanning primers of the GAPDH gene to confirm the absence of genomic DNA. The reverse transcription was performed on 2 µg of RNA from all nine tissues. The cDNA was extended from oligo(dT)12 primers during 1 h at 50°C by 200 U SuperScript RT III (Invitrogen) in a total volume of 20 µl. The cDNA from nine tissues was used as a template for PCR to check the transcription of NALP5, NALP8, and NALP9, and identity of transcripts was confirmed by sequencing.

Groups of 10 oocytes or embryos were used to isolate mRNA. The samples were heated to 80°C for 5 min and then placed on ice. Total embryo lysates (2 µl) were added to 2 µl of 2x binding buffer (20 mM Tris, pH 8.0, 1.0 M LiCl, 2 mM EDTA) and mixed briefly. The mRNA was incubated for 5 min at room temperature with 10 µl of oligo-(dT)-linked magnetic beads (Dynal), and washed twice with 50 µl wash buffer (10 mM Tris, pH 8.0, 0.15 M LiCl, 1 mM EDTA). After centrifugation (12,000 x g) the bound mRNA was resuspended in 3 µl double-distilled water followed by cDNA synthesis.

The quantification of transcripts of NALP5, NALP8, and NALP9 in ovary, testis, oocyte, and preimplantation embryos was carried out in LightCycler instrument (Roche) using LightCycler DNA Master SYBR Green I (Roche) and gene-specific primers, namely: 1) NALP9, F: TCATCGAACCGACAGTTATCC and R: AATATGTGCAGCCTGTCTGAG, 2) NALP8, F: gtgggatgccaagtgatagaand R: gatgttccagagctgcttcaand 3) NALP5, F: gcttcagtccctcgcacag and R: tcgtgctgcaagagtctgtc. The reaction mixture consisted of cDNA, 5 µM upstream and downstream primers, and LightCycler DNA Master SYBR Green I (1x). The template was amplified by 45 cycles of 95°C for 15 sec denaturation and 60°C for 10 sec annealing and 72°C for 15 sec for extension preceded by initial denaturation of 95°C for 10 min as a universal thermal cycling parameter. Based on the analysis of melting curves of the PCR products, a high-temperature fluorescence acquisition point was estimated and included in the amplification cycle program. For all assays, a standard curve was generated by amplifying serial dilutions of specific PCR product. Fluorescence signals, which were recorded online during amplification, were subsequently analyzed using the "Second Derivative Maximum" method of the LightCycler Data Analysis software. Normalization of variation in RT-PCR efficiency and initial RNA input was performed by using the GAPDH gene as internal standard. The mRNA abundance was analyzed in duplicate in each of two independent trials.

Analysis of cDNA and Genomic Sequences

To identify the bovine NALP9 gene, homology searches were performed in the bovine EST database (http://www.ncbi.nlm.nih.gov) using the human NALP9 cDNA sequence (GenBank accession no. AY154464). An EST clone (GenBank accession no. BM105687) with 72% homology to the 3' end, was identified. The sequence of this clone was used to screen a bovine BAC library (Bovine BAC [Babraham], Lib. no. 750; RZPD). Two BACs were identified, subcloned, and randomly sequenced. Bovine sequences identified to be homologues to human NALP9 were used to design primers for 5' RACE and 3' RACE PCR. Total RNA was isolated from 50 bovine immature denuded oocytes. 5' and 3' rapid amplification of cDNA ends (RACE) was performed by using the SMART RACE cDNA Amplification kit (BD Bioscience) according to the manufacturer‘s instructions. The resultant amplicons were separated by electrophoresis, extracted with the QIAGEN Gel Extraction Kit (Qiagen), ligated into a pGEM-T Easy Vector systems (Promega) and sequenced. Alignments were performed using BLASTn (http://www.ncbi.nlm.nih.gov/BLAST/). The ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and Pfam HMM databases (http://pfam.wustl.edu/hmmsearchs.html) were used to identify the ORF and protein domains of the bovine NALP9 cDNA sequences, respectively. Two bovine BAC clones were used to determine intron sequences and display intron-exon boundaries. The AG-exon-GT rule was applied to determine a splicing site between exon and intron [12].

Chromosomal Localization of Bovine NALP9 in Vicinity of a QTL Region for Reproductive Traits

The previously identified QTL region for stillbirth and nonreturn rate of 90 days as well as dystocia is flanked by markers BM2078 and TGLA227. These markers were used to screen a bovine BAC library. The positive clones were subcloned and randomly sequenced. At the same time, physical mapping of the NALP9 was performed using hybrid cell mapping and fluorescence in situ hybridization (FISH) analysis.

Hybrid cell mapping PCR typing of NALP9 was performed in 31 characterized cell lines of a bovine-hamster somatic-hybrid cell panel [13], and in 90 defined cell lines of a bovine-hamster 5000-rad whole genome radiation hybrid panel (WGRH5000) [14], as described by Goldammer et al. [15]. The WGRH typing experiment was performed twice, and data were scored independently. PCR products were scored as present (1), absent (0), or ambiguous (2). Two-point linkage analysis was done using the software package RHMAPPER [16] to assign the NALP9 locus to a chromosome and to the nearest marker of the bovine BTA18-RH5000 gene map [15].

Chromosome preparation and FISH Metaphase spreads were prepared from fibroblast cultures by standard cytogenetic techniques. Chromosomes were G-banded and 20 metaphase spreads were digitized. Karyotyping was performed for bovine G-banded chromosomes according to the International System for Chromosome Nomenclature of Domestic Bovids (ISCNDB) [17]. For FISH, the probe BAC BBI_B750F21140 harboring the bovine NALP9-encoding gene was labeled with biotin-16-dUTP using a nick-translation system kit (Invitrogen). The DNA mixture was prepared using 0.5 µg of the probe, 5 µg bovine C0t-1 DNA, and 20 µg salmon sperm DNA. Images were captured using a CCD camera system. The analysis of FITC fluorescence signals was performed on propidium iodide-stained chromosomes.

Northern Blot Analysis

Three micrograms of mRNA from ovary and testis were used for Northern analysis of bovine NALP9. A cDNA fragment of 778 bp was amplified using primer NALP9 for (CAGACTGACCAAGGCTTCAC) and NALP9-rev (TCATAACCCTCATTTGAAGC) to obtain a NALP9-specific probe. The cDNA probe was labeled with [32P]dCTP by random priming labeling kit (Amersham Biosciences). Easy Hyb buffer (Roche) was used for both prehybridization and hybridization. After hybridization at 50°C for 20 h, the membranes were washed twice with 1x SSC at room temperature for 30 min and twice with 0.2x SSC at 55°C for 30 min, followed by exposure to a PhosphorScreen.

In Situ Hybridization

Tissue samples were taken from an 18-mo-old bull and a 24-mo-old cow, frozen in liquid nitrogen, and then serially sectioned (10 µm) with a Leica cryotome. Slides were then fixed in 4% paraformaldehyde and washed in PBS. The same 778-bp fragment that was used for Northern analysis of the NALP9 cDNA was cloned in pGEM-T easy plasmid vector (Promega) and used to prepare digoxigenated sense and antisense RNA probes. The clone was linearized using NcoI for SP6 transcription (sense) and Ecl136II for T7 transcription (antisense) respectively. Transcription was performed by SP6 and T7 RNA polymerase (Roche) with digoxigenin-11-UTP following the producer's recommendations. For in situ hybridization, slides were rehydrated, digested with 2 µg/ml proteinase K (Roche) for 10 min, acetylated with 0.1 M triethanolamine and 0.25% acetic anhydride for 20 min, postfixed with 4% paraformaldehyde for 5 min, and treated with 0.3% H2O2 for 30 min to reduce residual peroxidases. The hybridization solution contained 50% formamide, 10% 50x Denhardts solution, 0.1 M TRIS-HCl, 0.005 M EDTA, 2.5 mg/ml yeast t-RNA, and 0.5 mg/ml polyadenylic acid. Prehybridization was performed using the hybridization mixture without probe at 37°C for 2 h. Hybridization was carried out overnight at 43°C with 5, 10, and 20 ng of antisense and 20 ng of sense probe as control. One slide was used as a second control in which both probes were omitted. After hybridization, slides were washed 2 times at 53°C in 2x SSC and 2 times at 53°C in 1x SSC under permanent agitation for 15 min each. Slides were then applied to RNase A treatment (10 µg/ml; Roche) at 37°C for 10 min and washed twice in 0.1x SSC at 50°C for 10 min each. After a short adaptation in 100 mM TRIS/150 mM NaCl buffer, slides were blocked with 5% sheep serum at room temperature for 1 h. Anti-DIG AP-fab fragment antibody (Roche) was diluted 1:300 in TRIS/NaCl buffer containing 1% sheep serum and 0.3% Triton x100. Antibodies were applied at 4°C in a wet chamber overnight. After 3 times washing in buffer under permanent agitation for 10 min, each signal was detected by NBT/BCIP ready-to-use detection system (Roche) and back-stained by 0.1% neutral red in water for 1 min. Photomicrographs were taken using a Nikon FXA microscope equipped with a Nikon Coolpix 5000 digital camera. Only a slight contrast enhancement with the same values for all images was performed.

RESULTS

Isolation and Characterization of Bovine NALP9 cDNA

The human NALP9 cDNA sequence was blasted to the NCBI database to search for homologous bovine DNA sequences. Three bovine ESTs (GenBank accession nos. CK775294, BM105687, and BM105684) were found being 72% homologous to the 3' region of human NALP9 cDNA. Primers designed from these ESTs were used to screen the BAC library. Two BACs were identified containing NALP9: BAC BBI_B750P06335 for the 5' region and BAC BBI_B750F21140 for the 3' region. Both of these BACs were subcloned and randomly sequenced. The sequences from these clones were used to design primers for 5' RACE and 3' RACE PCR. 3'- and 5' RACE primer relied on 3'- 5'-, 26-nt primer anchored at nucleotides 2043 and 2281 of the human NALP9 cDNA sequence (GenBank accession no. AY154464). This results in a 3204-bp full-length cDNA comprising 2988 bp of open reading frame (GenBank accession no. DQ092866). Nucleotide analysis of 3204 bp sequence displayed 67% similarity with human NALP9 (GenBank accession no. AY154464). The 5' and 3' untranslated regions were about 120 bp and 216 bp long, respectively. The ORF encodes a deduced protein of 996 amino acids with a predicted molecular mass of 110 kDa. The ORF of bovine NALP9 was searched against the Pfam HMM database [18]. This bovine NALP gene contains PYD, NACHT, and LRR domains like the human NALP family genes. A PYD domain was identified at amino acid position 11–94 at the amino terminus, followed by a NACHT domain at amino acid position 150–318, and the region containing 9 leucine-rich repeat domains at position 635–659, 691–714, 720–747, 748–772, 777–797, 805–832, 834–857, 862–889, and 891–918 toward the carboxy terminus (Fig. 1A). Comparison of deduced amino acid sequence of bovine and human NALP9 revealed 59.9% identity (Fig. 2). The bovine NALP9 has no standard consensus polyadenylation signal (AAUAAA). To confirm that the bovine NALP9 cDNA sequence comprises the full length, mRNA from bovine testis and ovaries were subjected to Northern blot analysis. The presence of five different transcripts suggests that NALP9 has different isoforms. Three transcripts were found in ovary and five in testis (Fig. 1B).


Figure 1
View larger version (33K):
[in this window]
[in a new window]
 
FIG. 1. Bovine NALP9 cDNA. A) Domains and motifs identified in the protein. B) NALP9 transcripts (marked by arrows; transcript obtained in testis only with dashed lines) detected by Northern analysis in ovary and testis


Figure 2
View larger version (87K):
[in this window]
[in a new window]
 
FIG. 2. Amino acid alignments of bovine and human NALP9. Arrowheads mark intron-exon boundaries in bovine NALP9

Genomic Organization of the Bovine NALP9 Gene

Two bovine BAC clones (BAC BBI_B750P06335 and BAC BBI_B750F21140) were used to determine the intron-exon boundaries of the gene. A series of intronic primers was designed and used for sequencing of these BACs. The bovine NALP9 has 9 coding exons. Exon-intron boundaries were determined by alignment of the NALP9 cDNA against the BAC sequence. All the observed splice acceptor and donor sites were in accordance with the consensus GT-AG rule (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Exon-intron sizes and boundaries of the NALP9 gene

Chromosomal Localization of the Bovine NALP9 Within a QTL Region for Reproductive Traits

Performing PCR with the NALP9 primers in the somatic hybrid panel, a bovine-specific band was detected in 15 of the 31 hybrid cell lines. The data vector obtained was: 0101000110 0000000000 0000001010 1. A concordance value of 0.94 with BTA18 reference marker UWCA5 allowed the syntenic assignment of NALP9 to BTA18.

The assignment to BTA18 was confirmed by PCR typing in the WGRH5000 panel. Double analysis in 90 selected cell lines of the WGRH5000 panel resulted in the vector: 1000011010 1001000000 0100111001 1001100101 1101000000 0101010010 0110101100 0010011100 0000110010. Thirty-five positive PCR signals in the 90 selected RH cell lines resulted in a relatively high retention frequency of 0.38, which was already found as typical for telomere RH markers on BTA18 [15]. RHMAPPER two-point linkage analysis combined with the data of the bovine BTA18 RH5000 gene map [15] placed NALP9 to BM2078 (LOD score 25.71; distance 0.0 cR5000; Fig. 3D). FISH mapping of the NALP9-encoding gene containing BAC BBI_B750F21140 confirmed the mapping results found with somatic hybrid cell mapping and anchored NALP9 on chromosome region BTA18q25-q26 (Fig. 3, A–C).


Figure 3
View larger version (42K):
[in this window]
[in a new window]
 
FIG. 3. Assignment of NALP9 to bovine chromosome BTA18. A) G-banded metaphase spread before FISH. B) Same metaphase after FISH with NALP9-encoding gene containing BAC probe BBI_B750F21140. C) Locus of NALP on BTA18q25–q26 according to ISCNDB 2000. D) Locus of NALP9 on the BTA18 RH5000 map

Selection and analysis of BAC clones and construction of a BAC contig within the region between the markers BM2078 and TGLA227 flanking a QTL for reproductive traits revealed that three members of the bovine NALP gene family are located in this QTL region (Table 2). Marker BM2078 is located in BAC BBI_B750K1683. NALP9 was found in BAC BBI_B750F21140. These BAC clones are overlapping. In the BAC BBI_B750H03188, which contained marker TGLA227, sequencing of random subclones revealed two clones homologous to Homo sapiens zinc finger protein 211 (ZNF211). In the human genome, NALP8 and NALP5 are adjected genes. Similarly, the bovine NALP8 and NALP5 were found in overlapping BACs (BAC BBI_B750G1831 and BAC BBI_B750K18359).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Genes and markers assigned to the QTL region for reproductive traits on BTA18 flanked by BM2078 and TGLA227, positive BAC clones, bovine Genbank sequences, and corresponding mapping position on human chromosome 19

Expression in Oocyte and Preimplantation Embryos

To evaluate the expression pattern of transcripts of NALP5, NALP8, and NALP9 during perifertilization, mRNA samples isolated from the immature oocytes, matured oocytes, 2-cell, 4-cell, 8-cell, 16-cell, morulae, and blastocyst stage embryos and were subjected to quantitative real time RT-PCR analysis. The transcripts of NALP5, NALP8, and NALP9 were detected in oocytes before and after in vitro maturation and with a gradual decline from 2-cell to 8-cell stage. The expression of NALP8 was detected in 16-cell stages at trace levels (Fig. 4). The highest expression level was found for NALP5, followed by NALP9 and NALP8 at all stages monitored.


Figure 4
View larger version (11K):
[in this window]
[in a new window]
 
FIG. 4. Expression patterns of NALP5, NALP9, and NALP8 in bovine oocyte and preimplantation embryos obtained by quantitative real time RT-PCR. IMO, Immature oocyte; MO, in vitro mature oocyte; 2C, two-cell embryos; 4C, four-cell embryos; 8C, eight-cell embryos; 16C, 16-cell embryos; Mor, morula; Bl, blastocysts. Relative units represent the signal intensity normalized with GAPDH (mean ± SD)

Expression of NALP9, NALP8, and NALP5 in Somatic and Gonadic Tissues

Total RNA from uterus, adrenal gland, intestine, lymphocytes, leukocytes, pituitary gland, liver, mammary gland, testis, and ovary were isolated and subjected to RT-PCR analysis with specific primers for NALP9, NALP8, and NALP5. As shown in Figure 5, transcripts of NALP9 and NALP8 genes were detected only in the ovary and testis. Transcripts corresponding to the NALP5 gene are limited to the ovary. For the NALP8 gene, an additional band, which is slightly longer, could be amplified from testis material. Transcript levels of NALP5, NALP8, and NALP9 in ovary and testis are shown in Figure 6. In all tissues and cells, examined expression profiles were similar, with the transcript abundance of NALP5 being highest followed by NALP9. The transcript level of NALP9 and NALP8 was higher in ovary than in testis (4- and 9-fold, respectively).


Figure 5
View larger version (46K):
[in this window]
[in a new window]
 
FIG. 5. Expression pattern of NALP5, NALP9 and NALP8 in bovine tissues by RT-PCR. RT-PCR for GAPDH is shown as a positive control


Figure 6
View larger version (9K):
[in this window]
[in a new window]
 
FIG. 6. Expression pattern of NALP5, NALP9, and NALP8 in bovine ovary and testis obtained by quantitative real time RT-PCR. Relative units represent the signal intensity normalized with GAPDH (mean ± SD)

To further characterize the localization of NALP9 transcripts within ovary and testis, in situ hybridization on ovarian and testis sections was performed. All slides containing the antisense probes showed dark purple-blue signals. There was no signal at slides containing the sense probe and the probeless slide (Fig. 7, B and F). In testis we found clear signals within the interstitial tissue around the seminiferous tubules (Fig. 7, A and C). This distribution indicates that NALP9 is expressed in Leydig cells. NALP9 transcript was detected as early as the primary follicle up to antral stage as well as in granulosa cells (Fig. 7, D, E, G, and H).


Figure 7
View larger version (105K):
[in this window]
[in a new window]
 
FIG. 7. Localization of NALP9 mRNA by in situ hybridization in testis (A–C) and ovary (D–H). A and C) Seminiferous tubules at different magnifications probed with NALP9 antisense probe. B) Control with corresponding sense probes. D) Section of the ovary at low magnification probed with NALP9 antisense probe. E, G) Primary follicles and secondary follicles probed with NALP9 antisense probe. F) Control with corresponding sense probes. H) Granulosa cells around antral follicles probed with NALP9 antisense probe

DISCUSSION

The antagonistic genetic relationship between milk production and fertility has become a major problem in the dairy industry, causing significant economic losses [19, 20]. Thus, improvement or at least maintenance of herd fertility has become a major objective in breeding programs worldwide. Members of the NALP gene family are important for gametogenesis, folliculogenesis, and early embryonic development in mice. In this study, we have characterized the genomic organization and the chromosomal position of bovine NALP9, and examined the temporospatial expression of NALP9, NALP5, and NALP8 genes in reproductive organs, as part of an investigation to determine their role in bovine fertility.

Structural Features of NALP9

Bovine NALP9 shares significant structural homology to other NALP gene family members with its C-terminal LRR and N-terminal PYD and NACHT domains. Orthologous genes from rat and mouse showed low degrees of conservation with human NALP9 (62% at the nucleotide level and 48% at the amino acid level by rat; 59% at the nucleotide level and 44% at the amino acid level by mouse). Similarily, low degrees of conservation between human NALP9 and bovine NALP9 were found in this study, with 67% at nucleotide and 59% at amino acid level. We established the intron-exon structure of bovine NALP9 by sequencing a genomic BAC clone and cDNAs. The longest bovine transcript of 3204 bp covers 2988 bp of coding sequence and exhibits the same structure as the human transcript variant NALP9.b, with nine exons and introns, including the shorter alternative first exon of 280 bp. Northern analysis revealed five different transcripts in bovine testis and three in bovine ovary. Similarly, various transcripts have been found in humans. These were first described as three transcripts (before June 2005), based on alternative splicing. More recently the annotation has been revised (August 2005), and two NALP9 transcripts have been defined that putatively encode two different protein isoforms. In addition, another variant has been annotated that is defined by seven cDNA sequences, covering a main exon but no introns, and that may be partial or unspliced (AceView; http://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/). Virtual Northern analysis using denuded immature bovine oocytes revealed a single transcript of about 3.7 kb [21]. However, the more heterogeneous source of RNA, ovary, used here led to the detection of different transcripts. The bovine model could be very useful for elucidating the function of the various transcripts, particularly because the level of complexity seems to be mirrored in humans.

Comparison of our NALP9 cDNA sequence with the sequence published by [21] revealed seven SNPs (nt733 A>G, nt915 C>T, nt1460 A>G G487E, nt1981 A>G A631T, nt1944 A>G, nt2001A>G, and nt2268 C>G E756D; nucleotide position of DQ092866) including three affecting the amino acid sequence and with the last one changing the LRR. These allelic variants may be associated with phenotypic variation.

Abundance of NALP9, NALP8, and NALP5 Transcripts

In this study transcripts of NALP9, NALP8, and NALP5 were detected in ovary and/or testis as well as in immature oocytes, matured oocytes, and 2- to 16-cell stages.

Transcription of bovine NALP9 is low in ovary and testis but higher in oocyte as well as preimplantation stage embryos. NALP9 transcript abundance decreases from immature oocyte to 8-cell stage, suggesting no reactivation at the time of bovine maternal to embryonic transition. Similar expression profiles of NALP9 were recently reported by Dalbies-Tran et al. [21]. In ovary, transcription of NALP9 was 1/20,000-fold compared to the endogenous control GAPDH. Abundance of NALP9 transcripts was 0.25-fold in testis compared to ovary. In situ hybridization revealed transcripts within the interstitial tissue around the seminiferous tubules in testis and follicles of different stages in ovary.

In agreement with the finding in human (AceView; http://www.ncbi.nih.gov/IEB/ Research/Acembly), we found low abundance of NALP8 and NALP5 transcripts in bovine gonads and preimplantative embryos. Transcript levels of NALP5 and NALP8 showed similar patterns to NALP9, with persistence of detectable transcript from oocyte through 2-cell to 8-cell stage but no indication of reactivation at time of embryonic genome activation. NALP5 has been addressed by several studies before in various species, including cattle, in which preferential expression in oocytes and preimplantation embryo up to eight-cell stages has been shown [6], which is in line with our findings. NALP5 was also observed in ovary but not in testis in human and mouse [4, 5]. Moreover, knockout experiments proved the relevance and maternal effect of NALP5 or Mater for the preimplantation development, with embryos of –/– females dying [4]. Temporal and spatial coordination of expression of NALP gene family members imply their role in gametogenesis, folliculogenesis, and early embryonic development. It could be suspected that NALP genes are involved in signaling cascades that mediate responsiveness of germ line cells and cells involved in generation, maturation, and development of germ line cells and early embryonic stages to hormones and to other exogenous or endogenous signals. However, the specific role of NALP genes in germ line cells on the one hand and somatic cells of gonads on the other hand remains to be determined.

Assignment of NALP9, NALP8, and NALP5 to a QTL for Reproduction on BTA18

These three bovine NALP gene family members were assigned to a QTL region for reproductive traits on chromosome 18, BTA18q25–q26. Recently, a QTL region for stillbirth (maternal effect) and nonreturn rate of 90 days (maternal and paternal effect) as well as dystocia (direct effect) has been found between marker BM2078 and TGLA227 in cattle [9]. This region was found also to contain QTL for mastitis susceptibly in dairy cattle [9, 22, 23]. In this study, NALP9 was mapped to the telomeric region of BTA 18 (BTA18q25–26) using the WGRH5000 panel as well as FISH on GTG-banded bovine chromosome. We have found that the region between bovine markers BM2078 and TGLA227 contains NALP9, NALP8, NALP5, and ZNF211. This region exhibits high evolutionary conservation to HSA19q [24]. In the human gene map, the region between NALP9 and ZNF211 is a region known to carry a large numbers of tandemly clustered Kruppel-type zinc finger-containing (ZNF) genes. 21 out of 52 genes in this region are zinc finger protein genes. Moreover, six NALP genes (NALP9, NALP11, NALP4, NALP13, NALP8, and NALP5) are located in this region. A number of oocyte- and germ cell-specific NALP genes were identified [68, 25]. Hamatani et al. [7] showed the relationships of amino acid sequence similarities of NALP gene family in human, mouse, and rat using a phylogenetic tree. This study showed that human NALP9, NALP11, NALP4, NALP8, and NALP5 are clustered to the mouse NALP gene family, which is specifically expressed in oocytes and/or testis. Interestingly, this NALP cluster family was found on chromosome 7A in mouse, which corresponds to human chromosome 19q43 [7, 8]. Based on the sequence homology and in silico library screening, NALP11 and NALP4 were predicted as gonad-specific genes. Unfortunately, no bovine orthologs are known. In this chromosomal region, the NALP gene family members are interesting candidate genes for reproductive traits.

Candidacy of NALP9, NALP8, and NALP5 for Reproductive Traits

Our study reveals several lines of evidence for the candidacy of NALP9, NALP8, and NALP5 for reproductive traits in cattle: 1) We showed expression of the genes being restricted to gonad cells, germ line cells, and preimplantation embryonic stages, confirming data previously collected for NALP9 [21] and in several studies for NALP5 [48]. For NALP5, biological evidence for impact on early embryonic development comes from the fact that Nalp5-null female mice show a block of the development of embryos regardless of the Nalp5 genotype of the embryos [4]. The temporally and spatially parallel expression of NALP9 and NALP8, which is shown here for the first time, together with NALP5 suggests their functional relevance for maternal effects on preimplantation development. 2) We have assigned NALP9, NALP8, and NALP5 to the distal region of bovine chromosome 18 containing QTL for stillbirth and nonreturn rate. The temporal pattern of expression and effects of NALP5 deficiency imply that the NALP gene family members are candidates for the QTL for nonreturn rate, whereas impact on stillbirth is not that likely. 3) For NALP9, we also found polymorphisms, including those changing the amino acid sequence in the functionally relevant LRR. These polymorphisms are thus likely to affect the function of the gene product.

In summary, coordinated parallel temporospatial expression in gonad cells including germ line cells and during preimplantation stages, assignment to a QTL region for reproductive traits on BTA18, and existing genomic variation, as evident for NALP9, promote bovine NALP5, NALP8, and NALP9 as candidate genes for fertility traits related to gametogenesis, oogenesis, and preimplantation development, and thus as strong candidates for investigation of allelic variations that are associated with the bovine QTL.

FOOTNOTES

1 Correspondence: Roland M. Brunner, Research Institute for the Biology of Farm Animals (FBN), Research Unit Molecular Biology, Wilhelm-Stahl-Allee 2, 18196 Dummerstorf, Germany. FAX: 0049 3820868701; brunner{at}fbn-dummerstorf.de Back

Received: 30 June 2005.

First decision: 28 July 2005.

Accepted: 2 December 2005.

REFERENCES

  1. Fairbrother WJ, Gordon NC, Humke EW, O'Rourke KM, Starovasnik MA, Yin JP, Dixit VM, The PYRIN domain: a member of the death domain-fold superfamily. Protein Sci 2001 10:1911-1918[Abstract/Free Full Text]
  2. Koonin EV, Aravind L, The NACHT family—a new group of predicted NTPases implicated in apoptosis and MHC transcription activation. Trends Biochem Sci 2000 25:223-224[CrossRef][Medline]
  3. Kobe B, Kajava AV, The leucine-rich repeat as a protein recognition motif. Curr Opin Struct Biol 2001 11:725-732[CrossRef][Medline]
  4. Tong ZB, Gold L, Pfeifer KE, Dorward H, Lee E, Bondy CA, Dean J, Nelson LM, Mater, a maternal effect gene required for early embryonic development in mice. Nat Genet 2000 26:267-268[CrossRef][Medline]
  5. Tong ZB, Bondy CA, Zhou J, Nelson LM, A human homologue of mouse Mater, a maternal effect gene essential for early embryonic development. Hum Reprod 2002 17:903-911[Abstract/Free Full Text]
  6. Pennetier S, Uzbekova S, Perreau C, Papillier P, Mermillod P, Dalbies-Tran R, Spatio-temporal expression of the germ cell marker genes MATER, ZAR1, GDF9, BMP15, and VASA in adult bovine tissues, oocytes, and preimplantation embryos. Biol Reprod 2004 71:1359-1366[Abstract/Free Full Text]
  7. Hamatani T, Falco G, Carter MG, Akutsu H, Stagg CA, Sharov AA, Dudekula DB, VanBuren V, Ko MS, Age-associated alteration of gene expression patterns in mouse oocytes. Hum Mol Genet 2004 3:2263-2278
  8. Dade S, Callebaut I, Paillisson A, Bontoux M, Dalbies-Tran R, Monget P, In silico identification and structural features of six new genes similar to MATER specifically expressed in the oocyte. Biochem Biophys Res Commun 2004 324:547-553[CrossRef][Medline]
  9. Kühn C, Bennewitz J, Reinsch N, Xu N, Thomsen H, Looft C, Brockmann GA, Schwerin M, Weimann C, Hiendleder S, Erhardt G, Medjugorac I, et al Quantitative trait loci mapping of functional traits in the German Holstein cattle population. J Dairy Sci 2003 86:360-368[Abstract/Free Full Text]
  10. Parrish JJ, Susko-Parrish JL, Winer MA, First NL, Capacitation of bovine sperm by heparine. Biol Reprod 1988 38:1171-1180[Abstract]
  11. Rosenkranz CF, First NL, Effect of free amino-acids and vitamins on cleavage and developmented rate of torine cygotes in vitro. J Anim Sci 1994 72:434-437[Abstract]
  12. Breathnach R, Chambon P, Organization and expression of eucaryotic split genes coding for proteins. Annu Rev Biochem 1981 50:349-383[CrossRef][Medline]
  13. Womack JE, Moll YD, Gene map of the cow: conservation of linkage with mouse and man. J Hered 1986 77:2-7[Abstract/Free Full Text]
  14. Womack JE, Johnson JS, Owens EK, Rexroad CE, III, Schläpfer J, Yang YP, A whole-genome radiation hybrid panel for bovine gene mapping. Mamm Genome 1997 8:854-856[CrossRef][Medline]
  15. Goldammer T, Kata SR, Brunner RM, Dorroch U, Sanftleben H, Schwerin M, Womack JE, A comparative radiation hybrid map of bovine chromosome 18 and homologous chromosomes in human and mice. Proc Natl Acad Sci U S A 2002 99:2106-2111[Abstract/Free Full Text]
  16. Slonim D, Kruglyak L, Stein L, Lander E, Building human genome maps with radiation hybrids. J Comput Biol 1997 4:487-504[Medline]
  17. Cribiu EP, Di Berardino D, Di Meo GP, Eggen A, Gallagher DS, Gustavsson I, Hayes H, Iannuzzi L, Popescu CP, Rubes J, Schmutz S, Stranzinger G, Vaiman A, Womack J, International System for Chromosome Nomenclature of Domestic Bovids (ISCNDB 2000). Cytogenet Cell Genet 2001 92:283-299[CrossRef][Medline]
  18. Bateman A, Haft DH, HMM-based databases in InterPro. Brief Bioinform 2002 3:236-245[Abstract/Free Full Text]
  19. Clay JS, McDaniel BT, Computing mating bull fertility from DHI nonreturn data. J Dairy Sci 2001 84:1238-1245[Abstract]
  20. Olori VE, Meuwissen THE, Veerkamp RF, Calving interval and survival breeding values as measure of cow fertility in a pasture-based production system with seasonal calving. J Dairy Sci 2002 85:689-696[Abstract]
  21. Dalbies-Tran R, Papillier P, Pennetier S, Uzbekova S, Monget P, Bovine mater-like NALP9 is an oocyte marker gene. Mol Reprod Dev 2005 71:414-421[CrossRef][Medline]
  22. Schrooten C, Bovenhuis H, Coppieters W, Van Arendonk JA, Whole genome scan to detect quantitative trait loci for conformation and functional traits in dairy cattle. J Dairy Sci 2000 83:795-806[Abstract]
  23. Schulman NF, Viitala SM, de Koning DJ, Virta J, Maki-Tanila A, Vilkki JH, Quantitative trait loci for health traits in Finnish Ayrshire cattle. J Dairy Sci 2004 87:443-449[Abstract/Free Full Text]
  24. Brunner RM, Sanftleben H, Goldammer T, Kuhn C, Weikard R, Kata SR, Womack JE, Schwerin M, The telomeric region of BTA18 containing a potential QTL region for health in cattle exhibits high similarity to the HSA19q region in humans. Genomics 2003 81:270-278[CrossRef][Medline]
  25. Horikawa M, Kirkman NJ, Mayo KE, Mulders SM, Zhou J, Bondy CA, Hsu SY, King GJ, Adashi EY, The mouse germ-cell-specific leucine-rich repeat protein NALP14: a member of the NACHT nucleoside triphosphatase family. Biol Reprod 2005 72:879-889[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Hum ReprodHome page
X. Wu
Maternal depletion of NLRP5 blocks early embryogenesis in rhesus macaque monkeys (Macaca mulatta)
Hum. Reprod., December 3, 2008; (2008) den403v1.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/3/577    most recent
biolreprod.105.045096v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ponsuksili, S.
Right arrow Articles by Schwerin, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ponsuksili, S.
Right arrow Articles by Schwerin, M.
Agricola
Right arrow Articles by Ponsuksili, S.
Right arrow Articles by Schwerin, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS