| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Embryo |
Environmental Health Sciences Division,3 National Institute for Environmental Studies, Tsukuba 305-8506, Japan
CREST,4 JST, Kawaguchi 332-0012, Japan
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
developmental biology, early development, embryo, growth factors, toxicology
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
One of the marked differences between preimplantation embryos and later stages of development is a genome-wide reprogramming of the DNA methylation pattern in vivo [7]. Typically, a substantial portion of the genome is demethylated and, later, remethylated in a cell- or tissue-specific manner. During this period, only certain genomic regions, so-called "imprinted genes," are protected from demethylation at the time of fertilization [8–10]. The genes that are imprinted are established during oogenesis and spermatogenesis [11]. In contrast to other genes, the methylated status of imprinted genes is maintained during embryogenesis, including the preimplantation stage [12], and transmission of these imprints is essential for normal embryonic development [11, 13]. In studies using preimplantation embryos cultured in vitro, several investigators have reported finding that aberrant growth and specific phenotypic abnormalities during fetal and postnatal development are sometimes associated with aberrant epigenetic modifications (i.e., with an altered methylation pattern in the genome during the preimplantation stage) [14, 15]. In addition, deregulation of imprints of several genes significantly affects postnatal growth and development [13, 16].
In the present study, we exposed murine preimplantation embryos to TCDD in vitro and then transferred them to unexposed recipient mice to determine how TCDD affects fetal development. Because imprinted genes are thought to be highly responsive to environmental conditions at the preimplantation stage and alteration of the methylation pattern has significant effects on fetal development [14, 15], we focused on alteration of the expression levels of two growth-related imprinted genes, H19 and Igf2, and we examined their genomic methylation status in the H19/Igf2 imprint control region after preimplantation exposure to TCDD.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The TCDD (purity, >99.5%) was purchased from Cambridge Isotope Laboratory (Andover, MA). The eCG and hCG were obtained from Teikokuzoki Co. (Tokyo, Japan). The M16 medium was from Sigma (St. Louis, MO). TRIzol reagent, SuperScript II reverse transcriptase, and oligo(dT)12–18 primer were from Life Technologies (Rockville, MD). Wizard DNA Clean-Up System and plasmid pGEM-T Easy vector were from Promega (Madison, WI). The QuantiTect SYBR Green PCR kit, HotStar Taq polymerase, and QIAprep Spin Miniprep Kit were from Qiagen (Valencia, CA). Poly(dI-dC:dI-dC), [3H-methyl]S-adenosylmethionine, and DYEnamic ET terminator cycle sequencing kit were from Amersham Biosciences (Piscataway, NJ). Other reagents were of analytical grade and were obtained from Nacalai Tesque, Inc. (Kyoto, Japan).
Embryo Collection, TCDD Exposure, and Transplantation
Animals were cared for humanely according to the guidelines for animal experiments of the National Institute for Environmental Studies. Male and female Jcl:ICR mice (age, 9–10 wk) were purchased from Charles River, Inc. (Tokyo, Japan). The animals were provided access to food and water ad libitum and kept on a 12L:12D photoperiod. Female mice were superovulated by i.p. injection with 5 IU of eCG, followed 48 h later by an i.p. injection of 5 IU of hCG. The superovulated females were allowed to mate with the males.
Embryos were collected from the oviduct at the 1-cell stage, approximately 21–23 h after hCG administration. The TCDD was dissolved in dimethyl sulfoxide and then added to M16 medium, and the dimethyl sulfoxide concentration in the medium was set at 0.1% in both the exposure and control groups. The TCDD was added to the medium to a concentration of 10 nM, because this concentration significantly induced CYP1A1 expression in blastocyst embryos without producing morphological changes [5]. The 1-cell embryos from the same donor mouse were equally divided into two groups. They were then cultured to the blastocyst stage in 200-µl drops of M16 medium drops (with or without 10 nM TCDD) and covered with mineral oil in a humidified atmosphere of 5% CO2 and 95% air at 37°C. After incubation, blastocyst embryos with clearly visible blastocoele cavities that had developed from the 1-cell stage were washed. The TCDD-exposed blastocysts were transferred into the one uterus, and the corresponding controls were transferred into another uterus of the same recipient female ICR mice (n = 7 blastocysts per horn).
Real-Time Reverse Transcription-Polymerase Chain Reaction
Fetuses were dissected on Embryonic Day (E) 14, and total RNA was purified from each whole fetus with TRIzol reagent and reverse transcribed with Superscript II reverse transcriptase. Quantitative real-time polymerase chain reaction (PCR) analysis was performed using the Roche LightCycler (Roche, Mannheim, Germany) [17] and the QuantiTect SYBR Green PCR kit according to the supplier's protocol. The primer sets used in the present study were as follows: H19: forward, taccccgggatgacttcatc; reverse, tatctccgggactccaaacc (GenBank accession no. Af049091, 7690–7875); Igf2: forward, gtgtgtgtcagccaagcatg; reverse, caaatgtggggacacagagg (GenBank accession no. U71085, 27066–27319); cyclophilin: forward, tggagatgaatctgtaggacgag; reverse, taccacatccatgccctctagaa (GenBank accession no. M60456, 172–554); G3PDH: forward, cacagtcaaggccgagaatg; reverse, tctcgtggttcacacccatc (GenBank accession no. M33599, 214–436). The amplification program was as follows: one cycle of 95°C for 15 min, followed by 35 cycles of denaturation for 15 sec at 95°C, annealing of primers for 20 sec at 56°C, and extension for 20 sec at 72°C. After completion of the final cycle, a melting curve analysis was performed to monitor PCR product purity. The identity of the PCR products was verified by agarose gel electrophoresis. Five serial dilutions, ranging from 0.125- to 2-µl aliquots of the reverse transcription (RT) reaction products, were used to construct the standard curve. All samples for each target gene were quantitatively analyzed simultaneously. Expression of the targeted gene transcript was calculated by linear extrapolation and normalized to that of G3PDH. The expression ratios for the various genes are reported relative to the mean expression ratio (adjusted to one) in the control group.
Bisulfite Genomic Sequencing
Genomic DNA was isolated from blastocyst embryos and E14 fetuses. Bisulfite treatment was performed as described previously [10, 18]. Briefly, the DNA was digested overnight with a NotI restriction enzyme and then subjected to denaturation for 20 min at 37°C with NaOH at a final concentration of 0.3 M. Freshly prepared 10 mM hydroquinone and 3.6 M sodium bisulfite were added to final concentrations of 0.5 mM and 3.1 M, respectively. The reaction mixture was incubated at 55°C for 16 h, and the DNA was then purified with the Wizard DNA Clean-Up System. The purified sample was resuspended in 50 µl of TE (10 mM Tris-HCl, pH 8.0, containing 1 mM EDTA) and denatured in 0.3 M NaOH at 37°C for 20 min. After neutralization with 3.0 M ammonium acetate, the DNA was ethanol-precipitated and resuspended in 50 µl of TE. The 430-base pair imprint control region of the H19/Igf2 gene (GenBank accession no. U19619, 1301–1732) (see Fig. 3) was amplified by PCR with HotStar Taq polymerase. Two rounds of PCR were performed with fully nested primer pairs. The primer set for the first-round PCR was as follows: forward, gagtatttaggaggtataagaat; reverse, atcaaaaactaacataaacc. The primer set for the second-round PCR (a nested PCR), was as follows: forward, tttgtaaggagattatgtttatttttggat; reverse, ccctaacctcataaaacccataactataaa. The PCR products were directly sequenced to analyze overall methylation status and subcloned into pGEM-T Easy vector to analyze the methylation pattern. The DNA sequencing was performed by Applied Biosystems (Foster City, CA) PRISM 310 Genetic Analyzer and the dideoxynucleotide chain termination method using the DYEnamic ET terminator cycle sequencing kit.
|
DNA Methyltransferase Activity Assay
Total DNA methyltransferase activity was assayed as previously described [15]. Briefly, embryos were transferred into 17 µl of assay buffer containing 130 µCi/ml of [3H-methyl]S-adenosylmethionine and lysed by four freeze/thaw cycles with dry ice in methanol. The unmethylated, double-stranded oligonucleotides [poly(dI-dC:dI-dC)] were added to the lysate, and the solution was then incubated for 2 h at 37°C. The poly(dI- dC:dI-dC) was precipitated by 10% trichloroacetic acid, resuspended in NaOH, and mildly acidified with HCl. Liquid scintillation counting was then performed.
Statistical Analysis
StatView for Windows version 5.0 (SAS Institute, Cary, NC) was used for the statistical analysis. All results are shown as the mean ± SEM. Differences in fetal weight were analyzed by two-way ANOVA, differences in gene expression by Student t-test, and differences in methyltransferase activity by paired Student t-test. Statistical significance was set at P < 0.05.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
To avoid the differences caused by donor mouse condition and culture time, embryos from the same donor mouse were equally divided into two groups and then cultured in medium with or without TCDD from the 1-cell stage through the blastocyst stage. The ratio of preimplantation embryos that developed was calculated by dividing the number of developed embryos by the number of 1-cell embryos initially present. No difference in ratio occurred between the control embryos and the TCDD-exposed embryos (data not shown). The data were collected from three experiments, with a total of 400–450 control and TCDD- exposed embryos.
At the end of in vitro culture, the blastocyst embryos cultured with or without TCDD that had morphology typical of E4 were washed. The TCDD-exposed blastocysts were transferred into the one uterus, and the control blastocysts were transferred into another uterus of the same normal recipient mice. The effects of TCDD were then evaluated based on fetal survival rate and fetal body weight. No significant difference in the survival rate of E14 fetuses was found between the TCDD (10 nM)-exposed embryos and the control embryos (data not shown). On E14, the weight of the fetuses exposed to TCDD from the 1-cell to the blastocyst stage was 18.9% lower than that of the controls (Fig. 1). The data were obtained from 15 control fetuses and 16 TCDD-exposed fetuses of four recipients. Two-way ANOVA (Table 1) revealed that the decrease in fetal weight had been induced by TCDD (P < 0.01), not by a litter effect (P > 0.05), and no interaction between TCDD effect and litter effect (P > 0.05) was found.
|
|
Gene Expression Level
The relative expression levels of Igf2 and H19 were determined in the whole fetal body on E14 by a real-time RT- PCR analysis of eight control fetuses and eight TCDD-exposed fetuses (two control fetuses and two TCDD-exposed fetuses from each litter). The housekeeping genes cyclophilin and G3PDH were used as controls. Expression of the targeted genes was normalized to that of G3PDH. The melting curve of each targeted gene had only one peak, demonstrating the specificity of the amplification. The sample with no target template was used as a negative control, and no primer dimers were found in the negative control. The graphs of fluorescence versus cycles for each sample provided by the LightCycler data analysis front screen are shown in Figure 2A, and the expression levels of H19, Igf2, and cyclophilin relative to G3PDH are shown in Figure 2B. For cyclophilin, no difference of expression was found between the control and TCDD-exposed group. The expression level of H19 was significantly decreased in the TCDD- exposed group. The expression level of Igf2 tended to be reduced, but the difference was not statistically significant.
|
Methylation Status in the Imprint Control Region of the H19/Igf2 Gene
We used the bisulfite genomic sequencing method to determine whether the suppression of H19 and Igf2 expression in E14 fetuses was associated with alteration of the methylation level and pattern in the H19/Igf2 imprint control region (Fig. 3) [9, 19, 20], which contains the CTCF- binding site involved in regulating the imprinted expression of H19 and Igf2. The bisulfite reaction converts unmethylated cytosine residues into uracil in the single-strand DNA, but it leaves 5-methylcytosine unchanged. The analyzed portion of the H19/Igf2 imprint control region is normally methylated at CpG sites on the paternal allele and unmethylated at CpG sites on the maternal allele (Fig. 4, top line) [21]. Figure 4B is a typical sequence chart showing no cytosine peaks (C-peaks) from maternally derived DNA after bisulfite treatment and subsequent PCR subcloning into plasmid vector. By contrast, the chart from paternally derived DNA (Fig. 4C) possesses C-peaks (arrowheads), representing methylated cytosine residues protected against bisulfite treatment, with unmethylated cytosines shown as thymine peaks (T-peaks, asterisks), in contrast to the chart from the direct sequence of the PCR product from untreated genomic DNA, in which the unmethylated cytosines are shown as C-peaks (Fig. 4A).
|
In a preliminary examination to evaluate a semiquantitative assay for cytosine/thymine content in the mixed DNA pool, maternally derived template plasmid clones (M) (Fig. 4B) and paternally derived template plasmid clones (P) (Fig. 4C) were mixed in different proportions (3:1, 1:1, and 1:3) and then amplified by the same PCR method as used in the bisulfite genomic amplification. The PCR products were then directly sequenced to yield the sequencing profiles shown in Fig. 4, D–F. Basically, two peaks, a T-peak and a C-peak, are detected at positions suspected of being 5-methylcytosine in the paternal genomic DNA. However, in the chart of the PCR product from the template with the M:P ratio of 3:1 (Fig. 4D), the T-peaks are clearly higher than the C-peaks. In the chart of the PCR product from the template with the M:P ratio of 1:1 (Fig. 4E), the T-peaks are as high as the C-peaks. In the chart of the PCR product from the template with the M:P ratio of 1:3 (Fig. 4F), the T-peaks are lower than the C-peaks. Three PCR reactions were carried out per sample, but the sequencing profiles of the PCR products were essentially identical. Although the ratio of the peak integration area in direct DNA sequencing profiles generally is not thought to be quantitative, these results demonstrated that at least in the H19/Igf2 imprint control region tested in the present study, the different heights of C- and T-peaks reflected the different cytosine/ thymine content in the mixed DNA pool before the PCR.
The experimental results of alteration of the methylation level by TCDD exposure are shown in Figure 5. Figure 5A (top) shows the direct sequencing profile of the PCR products from bisulfite-treated genomic DNA isolated from three sets of 240 control embryos and 240 TCDD-exposed embryos. In the control samples, the heights of the T- and C-peaks at positions suspected of being 5-methylcytosine in the paternal genomic DNA are almost the same level, whereas in the TCDD-exposed samples, the C-peaks are higher than the T-peaks. Three PCR reactions were carried out for each sample, but identical profiles were obtained. Based on the preliminary semiquantitative examination (Fig. 4), the present experimental results strongly suggested that the 5-methylcytosine content of the targeted region in the genomic DNA of TCDD-exposed embryos was higher than that in the control embryos.
|
To further investigate the alteration of the methylation pattern by exposure to TCDD, plasmid subclones were prepared from PCR products. In the control group, 15 (44.1%) of the 34 clones assayed from three PCR products exhibited methylation at any of the CpG sites, and 19 (55.9%) clones exhibited no methylation. In the TCDD-exposed group, on the other hand, 22 (64.7%) of 34 clones assayed from three PCR products had methylation at any of the CpG sites, and 12 (35.3%) of the clones exhibited no methylation (Fig. 5A, bottom). These findings strongly support the above-described direct sequencing profile, in that a higher methylation level of the H19/Igf2 imprint control region was observed in TCDD-exposed samples.
We also determined the methylation status of the H19/ Igf2 imprint control region in E14 fetuses with preimplantation embryos that were exposed to TCDD and in controls. Figure 5B (top) shows the bisulfite genomic sequencing profiles of the TCDD-exposed fetuses and the control fetuses; they are similar to DNA sequencing profiles of the preimplantation embryos. In the control samples, the C- peak is the same as the T-peak, whereas in the TCDD- exposed samples, the C-peak is higher than the T-peak. After subcloning and sequencing the PCR products, we found that 20 (50%) of 40 clones assayed from four fetus samples in the fetal control group exhibited methylation, and 20 clones (50%) exhibited no methylation, at any of the CpG sites. On the other hand, in the TCDD-exposed group, 29 (60.4%) of 48 clones assayed from four fetus samples exhibited methylation, and 11 clones (22.9%) showed no methylation, at any of the CpG sites. Interestingly, the CpG dinucleotides at the 5'-end of the remaining eight clones (16.7%) were methylated, and the CpG dinucleotides at the 3'-end were unmethylated. The level of methylation of all CpG dinucleotides and of the CpG dinucleotides at the 5'- end in the TCDD-exposed group was 10.6% higher and 27.3% higher, respectively, than the corresponding methylation level in the control group (Fig. 5B, bottom).
Methyltransferase Activity in the TCDD-Exposed Embryos
To determine whether the higher methylation level in the H19/Igf2 imprint control region after TCDD exposure was associated with methyltransferase activity, we measured the methyltransferase activity in preimplantation embryos. Because a marked, absolute decrease in enzyme activity has been reported from the 8-cell to the blastocyst stage [22], we equally divided embryos from each donor mouse into two groups and then cultured them in the medium with or without TCDD to prevent differences in fertilization time, embryo collection time, and culture time, which might have affected the results. At the end of in vitro culture, we selected embryos at a similar status of development (Fig. 6A) to measure the methyltransferase activity. Ten embryos in each group were used for the assays, each of which was conducted in triplicate. The experiments were repeated four times. The results of the paired Student t-test showed that TCDD-exposed embryos had significantly higher methyltransferase activity than the control embryos (P < 0.05) (Fig. 6B).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Explaining how TCDD affects the methylation status of imprinted genes during the preimplantation stage is not an easy task. However, we would address a possibility based on earlier studies concerning the mechanism of regulation of methylation and the regulation of TCDD effects [21, 23– 30]. The alteration of DNA methylation status is related to methyltransferase [21, 23, 24]. Cytosine methyltransferase enzyme catalyzes the transfer of an activated methyl group from S-adenosylmethionine to the 5-position of the cytosine ring. Two distinct types of methyltransferases involved in maintenance and establishment of genomic methylation pattern in mammals, Dnmt1 and Dnmt3, have been functionally characterized [23]. A variant of Dnmt1 protein, called Dnmt1o, is expressed in mouse oocytes and preimplantation embryos [21]. The Dnmt3b protein is specifically expressed in totipotential embryonic cells, such as inner cell mass, epiblast, and embryonic ectoderm cells, but it is downregulated in most adult somatic tissues [24]. It has been reported that expression of the Dnmt1 gene in somatic cells is controlled by Sp1 [25, 26] and that the minimal promoter region of Dnmt3b contains an Sp1 site [27]. Taken together, these reports suggest that alteration of Sp1 activity may affect the level of expression of DNA methyltransferases. On the other hand, it has been well documented that the effects of TCDD are mediated by the arylhydrocarbon receptor (AhR) and AhR nuclear translocator (Arnt), both of which are constitutively expressed in preimplantation embryos [5]. The Sp1 protein is also expressed during preimplantation development [28], and an in vitro transcription study using CYP1A1 promoter showed synergistic enhancing effects between AhR/Arnt and Sp1 [29]. After gestational exposure to TCDD, the amount of Sp1 DNA binding in the cerebral cortex and cerebellum was revealed to be maximal on Postnatal Day 3, as opposed to Postnatal Day 10 in the controls, suggesting modulation of the DNA-binding activity of Sp1 as a result of the transplacental dioxin exposure [30]. Thus, based on the possible ability of Sp1 to regulate DNA methyltransferase gene expression mentioned above, TCDD may have affected the DNA methyltransferase activity through Sp1. The present study showed that methyltransferase activity in the preimplantation embryos exposed to TCDD was higher than that in control embryos, and this finding may support the possibility described above that TCDD may alter DNA methyltransferase gene expression through an increment in Sp1 activity. However, in the present study, we cannot clarify which methyltransferase gene was responsible for hypermethylation of the H19/Igf2 imprinted control region by TCDD exposure. The mechanism of control for methylation needs further research.
To determine whether the later fetal development is affected by the exposure to TCDD during the preimplantation period in our experiments, TCDD-exposed preimplantation embryos were transferred to unexposed recipients. Because the embryo transplantation technique involves many complicated factors, such as the timing of blastocyst transfer and recipient condition, which may affect the results, TCDD-exposed blastocysts were transferred into the one uterus, and control blastocysts were transferred into another uterus of the same recipient mice. In addition, to avoid a possible effect of reduced numbers of fetuses, the comparisons were made only when at least three fetuses survived in each uterine horn. We found that under these experimental conditions, the methylation level of the H19/Igf2 imprint control region was still higher in the E14 fetuses exposed to TCDD during the preimplantation stage and that the resulting fetal body weight was significantly lower than that in the control. The results suggested that the alterations of the methylation status of imprinted genes by TCDD during the preimplantation stage persist at later fetal stages. In the present study, we employed an in vitro culture system for TCDD exposure, because we could expect that the system would rule out the effect of the mother's physiological changes induced by TCDD and mimic the environment of the oviduct to find a direct effect of TCDD on preimplantation development. Although the dosage of TCDD used in the present study was 10 nM, which is much higher than the actual TCDD concentration in the milieu around the embryos [4], we propose that this experimental model may provide a novel finding regarding a direct effect of TCDD on epigenetics during development. It is worth examining whether an environmentally relevant dose of TCDD affects the methylation status of the imprinting genes.
The imprinted gene Igf2 encodes a fetal growth factor and is expressed mostly on the paternal chromosome [31, 32], whereas the imprinted gene H19 is expressed almost exclusively on the maternal allele [33, 34]. The Igf2 gene is located before the H19 gene on mouse chromosome 7, and regulatory regions called enhancers are farther along the chromosome, after both genes. Both the paternal silencing of H19 and maternal repression of Igf2 depend on an H19/Igf2 imprint control region located 5' of the H19 gene. Transcription is triggered only when the enhancers interact with promoters located near each gene. The imprint control region on the maternal chromosome is unmethylated, which enables a zinc-finger protein, CTCF, to bind to several sites in the unmethylated imprint control region and block access of the enhancers to the Igf2 promoter to silence the gene. However, the enhancers can still interact with the H19 promoter; thus, H19 is active. When the imprint control region at the CTCF-binding site is methylated, however, the enhancers cannot interact with the H19 promoter and, instead, cause the Igf2 genes to be turned on [19, 20, 35, 36]. In the present study, we found a higher methylation level in the H19/Igf2 imprint control region of the TCDD-exposed group. This led us to expect decreased H19 and increased Igf2 expression levels, but the expression of Igf2 tended to decrease on E14. The mechanisms underlying the decreased expression of Igf2 are unknown, but histone acetylation is speculated to play a pivotal role. Recently, higher acetylation of the core histone H4 on active promoter regions, paternal Igf2, and maternal H19 was observed compared with the silent alleles, suggesting differential histone acetylation of two parental alleles as a potential mechanism of transcription regulation [37, 38]. Moreover, in addition to the H19/Igf2 imprint control region located 5' of the H19 gene, Igf2 has several differentially methylated regions (Igf2 DMR) located upstream and within the body of the gene that re-established the methylation pattern in the early postimplantation stages [39]. Deletion of the H19/Igf2 imprint control region may lead to methylation of the Igf2 DMR, and progressive methylation of the Igf2 DMR appears to be correlated with downregulation of Igf2 [40–42]. Thus, the distorted methylation level in the H19/Igf2 imprint control region may result in aberrant Igf2 gene expression at a later stage of development. Taken together, these results may explain why Igf2 expression was decreased instead of increased in the present study. Igf2 expression is thought to be associated with fetal growth [31, 43]. The tendency observed in the present study for fetal weight to decrease may be explained, in part, by alteration of the expression of H19 or Igf2.
In summary, the present study is the first, to our knowledge, to demonstrate that an environmental toxicant, TCDD, alters the methylation status of imprinted genes in early development and that the altered methylation status is maintained throughout the fetal stage. Although the mechanisms regulating expression levels of the imprinted genes H19 and Igf2 and fetal growth in terms of their methylation status remain to be clarified, the alteration of methylation status by TCDD exposure during the preimplantation stage is thought to affect both the imprinted gene expression level and fetal growth. These results provide new data for an epigenetic reprogramming mechanism and for the environmental health risk assessment.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence: Chiharu Tohyama, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba 305-8506, Japan. FAX: 81 298 50 2588; ctohyama{at}nies.go.jp
Received: 21 November 2003.
First decision: 17 December 2003.
Accepted: 3 February 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  A. C. Aragon, P. G. Kopf, M. J. Campen, J. K. Huwe, and M. K. Walker In Utero and Lactational 2,3,7,8-Tetrachlorodibenzo-p-dioxin Exposure: Effects on Fetal and Adult Cardiac Gene Expression and Adult Cardiac and Renal Morphology Toxicol. Sci., February 1, 2008; 101(2): 321 - 330. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Ovando, C. M. Vezina, B. P. McGarrigle, and J. R. Olson Hepatic Gene Downregulation following Acute and Subchronic Exposure to 2,3,7,8-Tetrachlorodibenzo-p-dioxin Toxicol. Sci., December 1, 2006; 94(2): 428 - 438. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Crews and J. A. McLachlan Epigenetics, Evolution, Endocrine Disruption, Health, and Disease Endocrinology, June 1, 2006; 147(6): s4 - s10. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Desaulniers, G.-H. Xiao, K. Leingartner, I. Chu, B. Musicki, and B. K. Tsang Comparisons of Brain, Uterus, and Liver mRNA Expression for Cytochrome P450s, DNA Methyltransferase-1, and Catechol-O-Methyltransferase in Prepubertal Female Sprague-Dawley Rats Exposed to a Mixture of Aryl Hydrocarbon Receptor Agonists Toxicol. Sci., July 1, 2005; 86(1): 175 - 184. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
