| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gamete Biology |
Centre for Cellular and Molecular Biology, Hyderabad 500 007, India
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
acrosome reaction, developmental biology, gamete biology, signal transduction, sperm capacitation
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
During capacitation, the spermatozoa undergo a change in motility pattern, a phenomenon called hyperactivation [6], which enables the hyperactivated spermatozoa to progress at a higher efficiency in the oviduct than nonhyperactivated spermatozoa [7]. The enhanced motility of hyperactivated spermatozoa presumably helps them to overcome the mucosal barrier of the female reproductive tract. Also, during the progression of capacitation, an array of proteins have been shown to undergo tyrosine phosphorylation in different species [8–13] and only a few of these proteins have been identified as yet. Involvement of protein kinase A [14] and protein kinase C [15] have been shown in capacitation. A kinase anchoring proteins have been identified as capacitation-dependent phosphorylated proteins in human [16], mouse [17], rat [18], and hamster [19] spermatozoa, although the type of phosphorylation (tyrosine/serine) depends on the species. Other proteins, namely heat shock protein 90 [20] and calcium-binding tyrosine phosphorylation-regulated protein [21], have also been found to get tyrosine phosphorylated in a capacitation-dependent manner in mouse spermatozoa. The phenomenon of capacitation terminates in acrosome reaction. During acrosome reaction, the outer acrosomal membrane fuses with the plasma membrane of the spermatozoon forming mixed membrane vesicles and subsequently releasing the vesicular contents. The released acrosomal contents have been implicated in oocyte zona pellucida penetration [22], thus making acrosome reaction an essential event for fertilization.
Studies on the molecular basis of capacitation became possible only after methods were standardized for in vitro capacitation of spermatozoa of human beings and many laboratory animals, including hamster [6]. Spermatozoa from various species can now be capacitated in vitro in balanced salt solutions supplemented with BSA and carbon sources like glucose, pyruvate, and lactate, which mimic the female reproductive tract environment [23]. The exact involvement of the carbon sources in the cellular changes during capacitation and acrosome reaction has not been fully worked out. In mouse and man, glucose has been shown to be the primary carbon source and glycolysis the primary pathway for capacitation of spermatozoa [24, 25]. On the other hand, in guinea pig spermatozoa, the role of the glycolytic pathway is not clear [26, 27]. In human spermatozoa, it has been postulated that glucose could be linked to the increase in superoxide generation, which is an essential step in hyperactivation and phosphorylation during capacitation [28]. Glycolysis, and not the electron transport chain, has also been indicated as a source of ATP for phosphorylation in mouse spermatozoa [29]. Despite all these earlier studies, the role of pyruvate and lactate in capacitation has not been worked out yet.
Dihydrolipoamide dehydrogenase is a post-pyruvate-lactate enzyme; its importance as a metabolic enzyme being reflected in the fact that the two identified missense mutations in the coding region of E3-deficient patients lead to clinical symptoms like lactic acidosis, neurological dysfunctions, and maple-syrup urine disease [30]. Dihydrolipoamide dehydrogenase is the E3 component of alpha-keto acid dehydrogenase multienzyme complexes [31]. E3 is a flavoprotein disulphide oxidoreductase with a molecular mass of 51 kDa. Dihydrolipoamide acetyltransferase, another component of the same multienzyme complexes, is the physiological substrate of E3. The enzyme is active as a dimer and the main catalytic activities of E3 are a) dehydrogenase, b) diaphorase, and c) oxidase [32]. Recently, E3 has also been implicated in biotransformation of hexahydro-1,3,5-trinitro-1,3,5-triazine by denitration [33]. E3 is a crucial enzyme in pyruvate metabolism as it forms a part of the pyruvate dehydrogenase complex, which metabolizes pyruvate directly. The enzyme has also been implicated in galactose transport into the cells in Streptococcus pneumonieae [34]. A recent report shows that the bacterial homologue of E3, in concerted activity with its physiological substrate and a thioredoxin-like protein, exhibits antioxidant activity in Mycobacterium tuberculosis [35]. E3 knockout mice die early in development and the heterozygotes show half of the enzyme activity of that of the normal [36]. No study so far has implicated E3 in reproductive functions.
In this paper, we have identified a tyrosine phosphorylated protein from the proteome of capacitated spermatozoa of Golden hamster (Mesocricetus auratus), as dihydrolipoamide dehydrogenase (E3). We have looked into the possibility of a testis-specific E3 that might exhibit this unique property of phosphorylation. A specific reversible inhibitor of E3, 5-methoxyindole-2-carboxylic acid (MICA) [37, 38], has been used to investigate the role of the enzyme in hamster spermatozoal hyperactivation, acrosome reaction, and phosphorylation, which are the three major events characterizing capacitation. Because E3 is a post-pyruvate metabolic enzyme, the role of pyruvate-lactate has been investigated in detail and we have delineated the temporal involvement of glucose and pyruvate-lactate in hamster spermatozoal capacitation. The results of our experiments suggest that dihydrolipoamide dehydrogenase has a dual role to play in capacitation during hyperactivation and acrosome reaction, and tyrosine phosphorylation of the enzyme could be a novel link between signaling and metabolism during hamster spermatozoal capacitation.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Male Golden hamsters (Mesocricetus auratus) aged 6 mo were used as experimental animals. All animal experiments were performed in accordance with the guidelines of the Institutional Animal Ethics Committee of Centre for Cellular and Molecular Biology. Spermatozoa were collected from the caudal epididymides in capacitation medium by the swim-up technique [19] and thereafter counted in a Makler chamber using a Computer Assisted Semen Analyzer (CASA), HTM-CEROS (Hamilton Thorne, Beverly, MA). Aliquots from the swim up were used for different studies. In vitro capacitation was achieved in the modified Tyrode medium [23] having the following composition: polyvinyl alcohol (2 mM), penicillin G (10,000 U), NaCl (114 mM), KCl (3.16 mM), CaCl2 (2 mM), sodium-lactate (10 mM), MgCl2 (0.5 mM), NaH2PO4 (0.35 mM), glucose (5 mM), NaHCO3 (25 mM), and a pinch of Phenol red. The osmolality and pH of the medium were adjusted to 290 mOsm and 7.5, respectively. The medium was freshly supplemented with PHE (2 mM penicillamine, 10 mM hypotaurine, 100 µM epinephrine), pyruvate (0.18 mM), and BSA (3 mg/ml) just before use. Hamster spermatozoa maintained in this medium in 5% CO2 at 37°C attained capacitation within 3–5 h [13]. As a modification, media with only glucose as carbon source (G) and with only pyruvate-lactate as carbon source (PL) were used. MICA was dissolved in the respective media by adding 10 N NaOH drop by drop. The pH and osmolality were then set at 7.5 and 290 mOsm, respectively.
Spermatozoal suspensions centrifuged at 0 h of capacitation were referred to as noncapacitated and those centrifuged at 5 h of capacitation was referred to as capacitated.
Phosphorylation
Five million spermatozoa were used to study tyrosine phosphorylation by SDS-PAGE immunoblot analysis. The spermatozoal pellets were washed twice with TBS (20 mM Tris buffer, 137 mM NaCl, pH 7.5) containing 1 mM sodium orthovanadate as phosphatase inhibitor and then suspended and boiled (10 min) in Laemmli buffer [39]. For two-dimensional PAGE (2D-PAGE) immunoblot analysis, 50 x 106 washed spermatozoa were suspended in urea lysis buffer (9.5 M urea, 2% NP40, 1.6% pI 5–8 Pharmalyte (Amersham Biosciences, Little Chalfont, UK), 0.4% pI 3–10 Pharmalyte, 5% ß-mercaptoethanol) and incubated on ice (1 h). The solubilized samples were centrifuged at 14 000 rpm (15 min) and resolved by SDS-PAGE [39] or 2D-PAGE [40] as the case may be. Gels were electrotransferred onto wet nitrocellulose membranes with 0.8 mA/cm2 current for 1.5 h. After the transfer, the membranes were stained with Ponceau S to check for equal loading of samples. Subsequently, membranes were processed for immunoblotting with polyclonal antiphosphotyrosine (
PY) antibody (Promega, Madison, WI) and it involved the following steps: a) blocking with 5% nonfat milk (1 h), b) incubation with 1:1000 dilution of primary antibody (PY) in 1% BSA in TBS-T (TBS containing 0.1% Tween 20) (1 h), c) incubation with 1:10 000 dilution of secondary antibody conjugated with horseradish peroxidase in 1% BSA in TBS-T (1 h). These steps were interspersed with washes with TBS-T. The blots were then developed using the Enhanced Chemi-Luminiscence kit (Amersham).
Acrosome Reaction
A minimum of 100 spermatozoa were scored for each time point using a phase-contrast microscope (Leitz Messetechnik, Wetzlar, Germany) with a 40x objective [13]. The samples were stained with eosin Y (0.25% in medium) and scored for spontaneous acrosome-reacted spermatozoa. The spermatozoa undergoing or having undergone acrosome reaction were counted as positive. The results were expressed as percentage of acrosome-reacted spermatozoa. To induce acrosome reaction, calcium ionophore A23187 (1 µM), was added to the respective media after 30 min of the dispersion of spermatozoa into these media [41].
Assessment of Hyperactivation
Our previous studies [42] show that nonhyperactivated and hyperactivated hamster spermatozoa exhibit different types of motility; nonhyperactivated spermatozoa exhibit planar type while hyperactivated spermatozoa exhibit circular or helical type of motility. Based on these criteria, motile spermatozoa could be visually categorized on the CASA monitor as hyperactivated or nonhyperactivated. The percentage of hyperactivated spermatozoa was thus counted and results show the average of 3–4 fields covering a minimum of a hundred spermatozoa. Hyperactivation was assessed in detail by studying the kinematics of the motile spermatozoa.
Kinematic Studies of Spermatozoa
The changes in velocity parameters during hyperactivation of spermatozoa were analyzed by CASA. Spermatozoal suspensions maintained in the different media were dispersed on prewarmed slide chambers (made with Parafilm [Pechiney Plastic Packaging, Chicago, IL] on glass slides), covered with cover slips [43] and 3–4 fields of each slide were recorded using HTM-CEROS. The percentage motility status of spermatozoa was assessed by manually counting the number of motile spermatozoa in the recorded fields and subsequently expressed as percentage of total number of spermatozoa. The same recorded samples were further analyzed for VAP (average path velocity), VCL (curvilinear velocity), and LIN (linearity) using the same software with the following set of parameters: frames acquired, 50; frame rate (Hz), 60; minimum contrast, 25; minimum cell size (pixels), 10; straightness threshold (%), 80; low VAP cut off (µm/sec), 7.5; medium VAP cut off (µm/sec), 12.5; low VSL cut off (µm/sec), 5; static head intensity limits, 0.2–1.47; static head-size limits, 0.12–7.37; static elongation limits, 1–98; magnification, 1.14 (4x); video frequency (Hz), 60; bright field, number; slide warmer temperature (°C), 37; field-selection mode, manual. About 100 spermatozoa from each recorded slide were analyzed for the kinematic parameters. Statistical significance of the inhibition of the kinematic parameters by the E3 inhibitor, MICA, was checked using Student t-test at the significance level of 0.05.
N-Terminal Sequencing
Hamster spermatozoal proteins were resolved by 2D-PAGE, transferred to polyvinylidene fluoride (PVDF) membranes (wet with methanol) with aforementioned conditions, stained with Ponceau S, and visualized. The protein spot of interest was then excised and subjected to N-terminal sequencing using an automated protein sequencer (Applied Biosystems, Foster City, CA).
Reverse Transcription-Polymerase Chain Reaction
Total RNA was isolated from hamster testis by TRI-reagent following the manufacturer's protocol (Sigma, St. Louis, MO). Reverse transcription was done using 50 U of Expand reverse transcriptase (Roche, Basel, Switzerland) with oligo dT as the primer. Polymerase chain reaction (PCR) was performed using gene-specific forward and reverse primers, which were synthesized in-house. The combination of overlapping primers used were BLF (5'ATGCAGAGCTGGAGTCGTGTGTACC3'-forward)/KAS2R (5'CTCTAAAAGCCTCTGATAAGGTCGGATG3'-reverse) and KASCF (5'TTGGTGTAGAATTGGGTTCAGTTTGGCAAAGAC3'-forward)/BLR (5'TTAAAAGTTGATTGGTTTTCCAAAAGCTGCAG3'-reverse); these amplified two fragments separately. The PCR products were run on 1% agarose gels. The bands were cut and eluted from the gel with Qiagen gel elution kit and sequenced in an automated sequencer (Applied Biosystems) with the respective primers.
Detergent Solubilization of Spermatozoa
The detergent-soluble spermatozoal lysates were prepared with capacitated and noncapacitated spermatozoal pellets according to the method of Patel et al. [31]. In brief, the pellet of 100 spermatozoa was suspended in 200 µl of hypotonic phosphate buffer containing 1% (v/v) TritonX-100, protease inhibitors (0.2 mM PMSF, 0.5 µg/ml leupeptin, 0.5 µg/ml aprotinin), and sodium orthovanadate (1 mM) and then kept on ice for 1 h. The suspension of cells was subjected to 3–4 freeze-thaw cycles and again kept on ice for 1 h, then centrifuged at 14 000 rpm for 15 min; the supernatant yielded detergent-soluble fraction and the pellet yielded detergent-resistant fraction of spermatozoa.
Generation of Antibody
Antibody against E3 was raised in mouse by injecting 30–40 µg of pig heart E3 as the antigen (Sigma). All injections were given subcutaneously, the first three being in Freund complete adjuvant and the later ones (one or two) in Freund incomplete adjuvant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In our earlier studies [19], it was demonstrated that an array of hamster spermatozoal proteins undergoes phosphorylation at tyrosine residues during capacitation. In the present study, among the proteins that underwent phosphorylation at the tyrosine residue(s) (detected in immunoblots using polyclonal antiphosphotyrosine antibody) in capacitated spermatozoa, a well-resolved and distinct protein spot with approximate relative molecular mass of 56 kDa and an isoelectric point of 7.3 (Fig. 1A) was chosen as a candidate to elucidate its role in capacitation. Tyrosine phosphorylation of this protein was confirmed by the abolition of the signal from this particular protein in a capacitated spermatozoal lysate when immunoblotted with the polyclonal antiphosphotyrosine antibody preincubated with O-phospho-L-tyrosine (Fig. 1, B–D). The candidate protein was also found to be tyrosine phosphorylated in capacitated samples when a monoclonal antiphosphotyrosine antibody (clone 4G10; Upstate, Charlottesville, VA) was used for immunoblotting (data not shown).
|
To identify this tyrosine phosphorylated protein, the particular protein spot was cut out from PVDF membranes after electrotransfer from a 2D-PAGE and sequenced, yielding 32 residues from the N-terminal end of the protein (Fig. 2A). A Swiss-Prot database search with these 32 residues using the BLAST algorithm [44] showed that the candidate was a mitochondrial protein, dihydrolipoamide dehydrogenase (Fig. 2A). The first residue of the candidate protein aligned with the 36th residue of the four mammalian E3s in the database. Residue 36 is the first residue of the processed form of dihydrolipoamide dehydrogenase, thus implying that the 56-kDa phosphorylated protein was the mature form of hamster spermatozoal dihydrolipoamide dehydrogenase. This identified protein will henceforth be referred to as hamster spermatozoal E3 in the article, as it is expected to be the E3 component of alpha-keto acid dehydrogenase multienzyme complexes [31].
|
|
An immunoblot analysis of the detergent-soluble (Sol) and -insoluble (Ins) hamster spermatozoal fractions, both capacitated (C) and noncapacitated (NC), with polyclonal anti-pig E3 antibody showed a single band at the 56-kDa position (Fig. 2C) in the soluble fractions only. This observation suggests that E3 is a part of the detergent-soluble fractions. Although the theoretical molecular mass of the mature hamster E3 is around 51 kDa, migration in SDS-PAGE and 2D-PAGE showed a molecular mass of around 56 kDa. This is a characteristic feature of the human E3 also [45]. E3 was the first enzyme shown to have diaphorase activity [46]. Thus, to identify NADH-dependent diaphorase activity of hamster spermatozoal E3, zymogram analysis was carried out using detergent-soluble spermatozoal lysate of hamster and compared with a corresponding native immunoblot with polyclonal anti-pig E3 antibody. Three diaphorase bands were observed in the soluble spermatozoal lysate of hamster (indicated by arrows in Fig. 2C), whereas in the native immunoblot, a single band was observed corresponding to one of the diaphorase bands. The diaphorase activity of hamster spermatozoal E3 was thus confirmed (Fig. 2C). The result would also imply that the detergent-soluble hamster spermatozoal lysate has two other diaphorase-active bands other than E3. Thus, hamster spermatozoal E3 shows the important general characteristic features of a dihydrolipoamide dehydrogenase and also exhibits a unique feature of tyrosine phosphorylation during capacitation.
Hamster Spermatozoal E3 Is Not a Testis-Specific Isozyme
This is the first report of E3 as a phosphorylated protein. Thus, to investigate if the hamster spermatozoal E3 is a novel testis-specific isoform, the hamster testis E3 cDNA was PCR amplified and sequenced using overlapping primers. The incomplete cDNA sequence of 
1.4 kilobases, after in silico translation, gave a partial sequence of hamster E3 that overlapped with the N-terminal amino acid residue of the mature hamster spermatozoal E3. The successfully sequenced portion of the cDNA, however, did not cover 14 amino acid residues at the C-terminal. This partial sequence included part of the mitochondrial transit (signal) peptide and all the structurally and functionally important residues of the enzyme [47]; the active site, FAD binding site, and the redox active cysteines being shown in Fig. 2A. Hamster spermatozoal E3, when aligned with other mammalian E3 sequences from pig, mouse, dog, and human, showed more than 90% identity with each of the other mammalian types (Fig. 2A). Most of the observed differences were due to conservative substitutions, which would in all probability be species specific. Thus, unlike quite a few metabolic enzymes, which have a testis-specific form [48–50], hamster spermatozoal E3 is not a testis-specific variant.
Inhibition of Hamster Spermatozoal E3 Inhibits Hyperactivation
To find out the involvement of hamster spermatozoal E3 in hyperactivation, if any, hyperactivation was assessed in the presence of a specific inhibitor of E3, MICA, in the capacitation medium. It is worthy of mention here that MICA (5 mM) has been previously used, by other workers, for bovine spermatozoa for inhibiting E3 to study pyruvate metabolism [51]. MICA had no significant effect on the percentage motility of hamster spermatozoa at doses below 10 mM (Fig. 3A). This decrease in percentage motility at the highest dose was due to reduction in the viability of spermatozoa (data not shown). Inhibition of E3 with 5 mM MICA delayed the acquisition of hyperactivation whereas 10 mM MICA decreased the percentage of hyperactivated hamster spermatozoa, but the lowest dose (2.5 mM MICA) had no considerable effect (Fig. 3B). However, a recovery in the effect was noticed with 5 mM MICA after 1.5 h of capacitation. Detailed analysis of the kinematic parameters representing hyperactivation [3, 42] revealed that the characteristic increase in VCL (curvilinear velocity) and VAP (average path velocity) were also affected in a dose-dependent manner in the range of doses tested (2.5–10 mM MICA) (Fig. 3, C and D). Further analysis of a single dose of MICA (5 mM) also revealed the recovery in the velocity parameters during the later time points of capacitation after 1.5 h (Fig. 4, A and D). The characteristic decrease in linearity (LIN) was not significantly affected by the down-regulation of E3 activity by MICA (Fig. 3E) but the decrease in LIN in the presence of MICA (5 mM) appeared to follow a different slope than the normal (Fig. 4G). These results indicate that hamster spermatozoal E3 had a direct involvement in hyperactivation of the spermatozoa during capacitation.
|
|
Pyruvate-Lactate Is Essential at the Later Stages While Glucose Is Essential at the Early Stages in Hamster Spermatozoal Hyperactivation
To investigate the involvement of pyruvate-lactate in hyperactivation of hamster spermatozoa, the velocity parameters and linearity of spermatozoa, maintained in medium with only glucose (G) or only pyruvate-lactate (PL) as carbon sources, were assessed and compared with those maintained in the control medium, which had all the three carbon sources. The percentage motility of the spermatozoa was not much hampered in any one of the media as compared with the control (data not shown). MICA (5 mM) was then used in G and PL media to determine involvement of hamster spermatozoal E3 on hyperactivation in the presence of each of these carbon sources. In the PL medium, the velocity parameters (VCL and VAP) and LIN of hamster spermatozoa were found to follow a different pattern of change compared with spermatozoa in the control medium, whereas spermatozoa incubated in the G medium behaved very similarly to spermatozoa in the control medium (Fig. 4, A–I). In the PL medium, there was a dip in VCL at 1.5 h, and VAP also did not show the characteristic increase at this time point. It is interesting to note that, although the velocity parameters of the spermatozoa in the PL medium were affected by inhibition of E3 (MICA 5 mM) at both early and late hours of capacitation, they were refractory toward inhibition at the same time point of 1.5 h (Fig. 4, B and E). This correlation suggests that, around 1.5 h, the motility was less dependent on E3 activity and pyruvate-lactate than other time points during capacitation. This indirectly suggests involvement of the other carbon source, glucose, on hyperactivation around this initial time point. In the G medium, inhibition of E3 (MICA 5 mM) affected the velocity parameters of the spermatozoa only during the later time point (5 h) and to a lesser degree than it affected spermatozoa in the PL medium (Fig. 4, C and F). This reduction by MICA could be due to the dependence of hyperactivation on E3 to metabolize pyruvate-lactate produced from glucose after glycolysis. The effect of MICA on LIN of hamster spermatozoa in the different media was, however, not significant. These results together indicated specific time-dependent involvement of glucose and pyruvate-lactate in hamster spermatozoal hyperactivation. To confirm this, spermatozoa were maintained in G medium for first 2 h and then shifted to G or PL medium separately; spermatozoa shifted from control to the same medium served as a positive control while those shifted from G to negative medium (without any carbon source) served as a negative control. As Figure 5, A and B, shows, the velocity parameters of the spermatozoa shifted to PL medium were comparable with the positive control levels while those shifted to G medium gradually decreased close to negative control levels. However, LIN did not show any considerable difference in any of the media. This definitely proves that glucose is essential in the early stages whereas pyruvate-lactate becomes important in the later stages in hamster spermatozoal hyperactivation.
|
Specific Inhibitor of Hamster Spermatozoal E3 Blocks Acrosome Reaction
To determine the role of hamster spermatozoal E3 on hamster spermatozoal acrosome reaction, if any, MICA was used in the capacitation medium to find out its effect on acrosome reaction. When MICA was added to inhibit E3 from the beginning of capacitation (0 h), there was a drastic inhibitory effect on acrosome reaction of hamster spermatozoa and the inhibitory effect was found to be dose dependent in the range of 1 to 5 mM MICA. In the presence of MICA, the spermatozoa were unable to show the characteristic increase in percentage acrosome reaction as shown by the spermatozoa in the absence of MICA (Fig. 6A). Further, inhibition of E3 (MICA 5 mM) at different time points of capacitation (1.5 and 3 h), by addition of the inhibitor at the respective time points, also inhibited the acrosome reaction (Fig. 6B). These results imply that hamster spermatozoal E3 activity is directly essential for acrosome reaction.
|
Calcium Reverses the Effect of E3 Inhibition on Acrosome Reaction
Because Ca2+ influx is a prerequisite for acrosome reaction [22], calcium ionophore A23187 was used along with MICA to check if calcium influx can overcome the inhibition of acrosome reaction by the E3 inhibitor. It was observed that induction of acrosome reaction by 1 µM A23187 in the presence of 1 mM MICA, at 1- and 3-h time points, was comparable with the 1 µM A23187 induction of acrosome reaction in the control (without MICA), while the degree of induction of acrosome reaction by 1 µM A23187 was much less in the presence of 5 mM MICA (Fig. 6C). The solvent DMSO showed no characteristic increase in acrosome reaction. At the same points (1 and 3 h) the spontaneous acrosome reaction either in the presence or absence of MICA (1 and 5 mM) is also shown in the figure. The recovery of acrosome reaction by the calcium ionophore from the dose-dependent inhibition of E3 thus indicates that an excess of calcium in the spermatozoa can relieve the effect of E3 inhibition by MICA.
Pyruvate-Lactate Is Essential for Acrosome Reaction of Hamster Spermatozoa
To find out if pyruvate-lactate is essential for hamster spermatozoal acrosome reaction, the spermatozoa were maintained in media with only glucose (G) or only pyruvate-lactate (PL) as carbon sources and the percentage of spermatozoa exhibiting acrosome reaction was monitored. Percentage acrosome-reacted spermatozoa in the G medium was comparable with that of the control (with all the three carbon sources), whereas the spermatozoa in the PL medium did not show the characteristic time-dependent increase in percentage acrosome reaction (Fig. 7A). However, when spermatozoa were maintained in G medium for the first 2 h and then shifted to PL medium, the percentage acrosome reaction was then comparable with that of the control (spermatozoa incubated in control/G media and shifted to control) (Fig. 7B). The acrosome reaction in the glucose-primed spermatozoa was abolished when transferred to PL medium containing MICA (5 mM) (Fig. 7B). Because MICA inhibits pyruvate-lactate metabolism by inhibiting E3, this observation strongly suggests that glucose plays a priming role for acrosome reaction and that pyruvate-lactate becomes essential at the later stages of capacitation when acrosome reaction is happening. In the G medium, pyruvate-lactate synthesized from glucose via glycolysis was presumably used for acrosome reaction in the later stages of capacitation. As a result, having only glucose as the carbon source in capacitation medium probably enables a normal increase in the percentage acrosome reaction. To further support this presumption, MICA (5 mM) was used in the G and PL media to check if inhibition of E3 can affect the acrosome reaction. The percentage acrosome reaction of the spermatozoa in G medium, which was normally comparable with that of the control, was inhibited by inhibition of E3 to the same extent as the control (Fig. 7C). Addition of 5 mM MICA to the PL medium did not either increase or decrease the percentage acrosome reaction, which was already inhibited in the PL medium in the absence of MICA. These observations strongly suggest that the acrosome reaction of hamster spermatozoa is under the influence of pyruvate-lactate, thus making functioning of post-pyruvate-lactate enzyme E3 indispensable. It also appears that pyruvate-lactate is required for acrosome reaction of hamster spermatozoa only when they are primed by glucose in the beginning of capacitation.
|
Hamster Spermatozoal E3 Does Not Play Any Role in Tyrosine Phosphorylation Cascade
To find out if hamster spermatozoal E3 is involved in the tyrosine phosphorylation cascade, MICA (5 mM) was used to see if downregulation of E3 activity brings about any change to the tyrosine phosphorylation level of proteins during capacitation. In contrast with the effect of inhibition of E3 (5 mM MICA) on acrosome reaction and hyperactivation, it did not have any effect on the tyrosine phosphorylation of hamster spermatozoal E3 or any other protein during capacitation (Fig. 8). This indirectly suggests that E3, although itself getting tyrosine phosphorylated, is not involved, directly or indirectly, in the signal transduction cascades, which bring about phosphorylation in an array of proteins during hamster spermatozoal capacitation.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
E3 is a housekeeping enzyme with a very significant role in metabolism. It is only very recently that other roles of the enzyme, such as in the redox system [35] and in the transport of sugars [34], are coming to light. The molecular mass of hamster spermatozoal E3 is 56 kDa with a pI of 7.3, as estimated from its migration in 2D-PAGE; the partial protein sequence that covers all the important residues is more than 90% identical to other available mammalian E3 sequences. The enzyme forms a part of the detergent-soluble fraction of hamster spermatozoa and also shows NADH-dependent diaphorase activity. The enzyme, for the first time, is shown to be phosphorylated at tyrosine residue(s) in capacitated hamster spermatozoa. However, no signal was observed for this protein in 2D immunoblots using monoclonal antiphosphoserine antibody (Sigma) in both noncapacitated or capacitated hamster spermatozoal samples (data not shown). Whether E3 of other mammalian spermatozoa get tyrosine phosphorylated still remains unchecked, but two reports are interesting from this point of view: one, a report on bovine spermatozoal capacitation, which mentions a 56-kDa tyrosine phosphorylated protein that is upregulated during heparin-induced capacitation [52]; and two, a tyrosine-phosphorylated protein in the midpiece (housing mitochondria) of mouse spermatozoa, which has been correlated with fertilization [53]. Because we identified a tyrosine-phosphorylated protein of 56 kDa, which is supposed to be a mitochondrial protein as hamster spermatozoal E3, it can be speculated that these aforementioned proteins in these other two species could also have the same identity. A sequence analysis of the available E3s (Fig. 9) indicates a probable site for phosphorylation. Among the nine tyrosines present in the protein, the tyrosine pointed out in Figure 9 and Figure 2A in the FAD binding region is conserved in all the species. This particular residue is also close to the active site as brought out in a modeling of Bacillus stearothermophilus E3 [32]. Moreover, the same tyrosine residue has been implicated in dimerization of the enzyme, and alteration of this tyrosine to serine or phenylalanine causes reduction in the activity of the enzyme, making it more sensitive to NADH inhibition in Azotobacter vinelandii [54]. However, phosphopeptide mapping of E3 from capacitated hamster spermatozoa would be needed to confirm the site of phosphorylation.
|
Our findings also suggest that hamster spermatozoal E3 is essential for hyperactivation during capacitation and also for the postcapacitation event called acrosome reaction, as both the events were affected by the specific E3 inhibitor, MICA. Because acrosome reaction is more sensitive to E3 inhibition than hyperactivation (Figs. 3B and 6A) and the fact that acrosome reaction is inhibited even if E3 is inhibited after hyperactivation has set in at 3 h (Fig. 6B), it is probable that the role of hamster spermatozoal E3 is different with respect to acrosome reaction and hyperactivation. E3, being a component of pyruvate dehydrogenase complex, would be required to be functional so as to be able to metabolize pyruvate-lactate through the multienzyme complex. The data demonstrating that pyruvate-lactate is essential for both hyperactivation and acrosome reaction of hamster spermatozoa (Figs. 5, A–C, and 7, A–C) thus corroborates the involvement of hamster spermatozoal E3. However, further direct experiments will shed light on the role of pyruvate-lactate in hyperactivation and acrosome reaction. It is to be recalled that the time point 1.5 h has emerged as a critical time point during hyperactivation in our studies as far as carbon sources requirement is concerned. At this time point, hamster spermatozoa in PL medium were refractory toward E3 inhibition (Fig. 4, B and E) and, at the same point, the spermatozoa in control medium start showing some recovery from the inhibitory effect of MICA (Fig. 3B). In control medium, inhibition of E3 and thus pyruvate-lactate metabolism would force the spermatozoa to shift toward glucose metabolism altogether and the recovery can be explained thus, as this is not observed in the absence of glucose (PL medium; Fig. 4, B and E). We also show that hamster spermatozoa, only when primed by glucose in the initial stages of capacitation, are able to undergo hyperactivation and acrosome reaction in the presence of only pyruvate-lactate (Figs. 5, A–C, and 7, A–C). The decrease in velocity parameters of glucose-primed hamster spermatozoa when shifted to G medium could be explained by the earlier observation in mouse spermatozoal capacitation, which indicated that the sharp uptake of glucose happens only in the beginning of capacitation [55]. Priming by glucose could be by a by-product of glycolysis, as indicated by the essentiality of presence of a glycolysable sugar for acrosome reaction in mouse spermatozoa [24]. NADH has been implicated in aiding pyruvate metabolism in the mitochondria of pancreatic islets [56]. Thus, NADH, which is also a by-product of glycolysis, can be thought of as a putative priming agent for hyperactivation and acrosome reaction. Studies on human and mouse spermatozoa capacitation have brought out glucose as the critical energy substrate. However, in guinea pig spermatozoa, pyruvate-lactate alone has been shown to be important for acrosome reaction [27]. Bavister and Yanagimachi also reported that pyruvate-lactate alone supports acrosome reaction (more than glucose) in hamster spermatozoa [57]. Our data, apart from revealing the essentiality of pyruvate-lactate, also highlights the importance of glucose priming in hyperactivation and acrosome reaction of hamster spermatozoa. Considering the possibility that spermatozoal extracts, which were used as motility stimulators in the former report, might have enough glucose to prime the spermatozoa and could thus bridge the difference between the results of Bavister and Yanagimachi [57] and our observation. Thus, we delineate the role of glucose as a priming agent and pyruvate-lactate as the real carbon source for acrosome reaction of hamster spermatozoa, highlighting the importance of a post-pyruvate-lactate metabolic enzyme, E3. Epididymal spermatozoa are more under the influence of glycolysable sugars like glucose and fructose [58, 59] and the concentration of lactate is more than glucose in the follicular fluid [60]. Therefore, in this context, our finding becomes relevant, indicating that spermatozoa get triggered for capacitation in the female tract where pyruvate-lactate might replace glucose as a carbon source. Our results suggest that, probably in other species also, pyruvate-lactate yielded after glycolysis might prove to be important for hyperactivation and acrosome reaction rather than glucose directly.
The undisputed role of calcium in acrosome reaction makes it very obvious to check if hamster spermatozoal E3 is involved with calcium in the acrosome reaction in any way. We observed that the influx of Ca2+ ions by using calcium ionophore A23187 reverses the inhibitory effect of E3 inhibition on acrosome reaction. This would definitely mean that the role of hamster spermatozoal E3 on acrosome reaction is either upstream of the Ca2+ influx or the ion is by itself responsible for relieving the enzyme of the inhibition by MICA. The second possibility is supported by the study, on the basis of the effect of zinc on E3, which proposes that metallic divalent cations could alter E3 activity in such a way that the enzyme acts more like an oxidase than a dehydrogenase, thus producing more a reactive oxygen species (ROS). Timely generation of a controlled level of ROS is an essential component during capacitation [61] and involvement of flavoproteins [28, 62] and diaphorases [63] in ROS generation during capacitation have been reported. Thus, hamster spermatozoal E3, which is a flavoprotein and a diaphorase too, can be speculated to be a direct or indirect component of the ROS-generating machinery in spermatozoa. The increase in activity of E3 during acrosome reaction would use more and more pyruvate-lactate to produce NADH, through pyruvate dehydrogenase complex and Krebs cycle, which would then be used up by an oxidase (or E3 itself) to produce hydrogen peroxide and further generation of ROS.
Tyrosine phosphorylation has been demonstrated to play a very important role in signaling events in almost all cell types, and spermatozoa are no exception; the uniqueness of spermatozoa being that an array of proteins are tyrosine phosphorylated during spermatozoal capacitation, in contrast with only 1% tyrosine phosphorylation seen in other eukaryotic cell types [64]. However, whether tyrosine phosphorylation is the cause or effect of capacitation still remains to be understood. Thus, any capacitation-dependent tyrosine phosphorylated protein, like hamster spermatozoal E3, becomes a handle to elucidate the cause-and-effect relationship of capacitation and tyrosine phosphorylation. Our preliminary studies (unpublished) reveal that the enzymatic activity of hamster spermatozoal E3 varies during capacitation. Because phosphorylation has proven to be a regulatory key for many metabolic enzymes, like hexokinase and pyruvate dehydrogenase, it will be interesting to find out whether the change in hamster spermatozoal E3 activity is related to the event of phosphorylation. Ficarro et al. have identified the E1ß subunit of pyruvate dehydrogenase of human sperm to be tyrosine phosphorylated, which is again a novelty in the spermatozoa [65]. Probably a new revelation in the regulation of the pyruvate dehydrogenase complex in capacitated spermatozoa is awaited.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence: S. Shivaji, Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad 500 007, India. FAX: 00 91 40 27160591; shivas{at}ccmb.res.in
Received: 4 September 2003.
First decision: 28 September 2003.
Accepted: 7 November 2003.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
G) or to only pyruvate-lactate (G 
