| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Embryo |
Oregon National Primate Research Center,3 Beaverton, Oregon 97006
Departments of Obstetrics and Gynecology and of Physiology and Pharmacology,4 Oregon Health and Science University, Portland, Oregon 97201
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
developmental biology, early development, embryo, gene regulation
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The role of Oct-4 in the maintenance of pluripotent cell populations has been established by targeted disruption of the endogenous gene and the subsequent demonstration that Oct-4-deficient mouse embryos fail to form an ICM [9]. Embryos homozygous for a targeted deletion of Oct-4 developed in vitro into blastocyst-like structures that were comprised solely of TE cells and failed to implant. Thus, an analysis of expression patterns in the mouse suggests that Oct-4 is involved in the initial formation, self-renewal, and maintenance of pluripotent cells.
Orthologues to the mouse Oct-4 gene, including human and bovine, share a high degree of genomic structural organization and sequence conservation [10, 11], thereby suggesting that Oct-4 plays a similar role in all mammals. Much higher levels of Oct-4 mRNA expression have been detected in the ICM as opposed to the TE of human blastocysts [12], but in bovine and porcine expanded blastocysts, immunocytochemical analysis has detected Oct-4 protein in both the ICM and TE [13]. Additionally, Oct-4 expression was not detected in human pluripotent embryonic germ cells [14]. This marked difference in Oct-4 expression compared to that in the mouse challenges the thesis that Oct-4 acts as a unique master regulator of pluripotent cells across mammalian species.
Given its unique expression pattern and critical role in maintaining pluripotency in the mouse, we sought to clarify Oct-4 temporal and spatial expression profiles in monkey pluripotent cell populations. Such profiles in the monkey were similar to those in the mouse, suggesting that Oct-4 also provides a useful marker for pluripotency in primates. In addition, we studied Oct-4 expression in monkey somatic cell nuclear transfer (NT) embryos in an effort to establish markers for monitoring nuclear reprogramming.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Inbred CF1 mice and mature rhesus macaques were housed and exposed to procedures approved by the Institutional Animal Care and Use Committee at the Oregon National Primate Research Center/Oregon Health & Science University.
Recovery of Mouse Oocytes, Zygotes, and Embryo Culture
Females (age, 4–6 wk) were superovulated with injections of 5 IU of eCG (Sigma-Aldrich, St. Louis, MO) and 5 IU of hCG (Sigma-Aldrich) given 48 h apart. Zygotes and embryos were collected from the oviducts of naturally mated females on the morning after hCG injection, stripped of cumulus cells by mechanical pipetting after brief exposure (<1 min) to hyaluronidase (0.5 mg/ml), placed in KSOM medium (Simplex Optimized Medium with elevated potassium [15]; Specialty Media, Phillipsburg, NJ), and cultured at 37°C in 5% CO2, 5% O2, and 90% N2. Preovulatory oocytes were isolated from excised ovaries of nonmated females 48 h after eCG injection by puncturing large follicles.
Ovarian Stimulation, Recovery of Rhesus Macaque Oocytes, Fertilization by Intracytoplasmic Sperm Injection, and Embryo Culture
Controlled ovarian stimulation and oocyte recovery has been described previously [16]. Briefly, cycling females were subjected to follicular stimulation using twice-daily intramuscular injections of recombinant human FSH as well as concurrent treatment with Antide, a GnRH antagonist, for 8–9 days. Unless indicated otherwise, all reagents were from Sigma-Aldrich, and all hormones and Antide were from Ares Advanced Technologies, Inc. (Norwell, MA). Females received recombinant human LH on Days 7–9 and recombinant hCG on Day 10. Cumulus-oocyte complexes were collected from anesthetized animals by laparoscopic follicular aspiration (28–29 h post-hCG) and placed in Hepes-buffered TALP (modified Tyrode solution with albumin, lactate, and pyruvate) medium [17] containing 0.3% BSA (TH3) at 37°C. Oocytes stripped of cumulus cells by mechanical pipetting after brief exposure (<1 min) to hyaluronidase (0.5 mg/ml) were placed in chemically defined, protein-free HECM-9 (hamster embryo culture medium) [18] at 37°C in 5% CO2, 5% O2, and 90% N2 until further use.
Fertilization by intracytoplasmic sperm injection (ICSI) and embryo culture were performed as described before [19]. Briefly, sperm were diluted with 10% polyvinylpyrrolidone (1:4; Irvine Scientific, Santa Ana, CA), and a 5-µl drop was placed in a micromanipulation chamber. A 30-µl drop of TH3 was placed in the same micromanipulation chamber next to the sperm droplet, and both were covered with paraffin oil (Zander IVF, Vero Beach, FL). The micromanipulation chamber was mounted on an inverted microscope equipped with Hoffman optics and micromanipulators. An individual sperm was immobilized, aspirated into an ICSI pipette (Humagen, Charlottesville, VA), and injected into the cytoplasm of a metaphase II-arrested (MII) oocyte away from the polar body. After ICSI, injected oocytes were placed in four-well dishes (Nalge Nunc International Co., Naperville, IL) containing protein-free HECM-9 and cultured at 37°C in 5% CO2, 5% O2, and 90% N2. Cultures were maintained under paraffin oil. Embryos at the 8-cell stage were transferred to fresh plates of HECM-9 supplemented with 5% fetal bovine serum (FBS; HyClone, Logan, UT) and then cultured for a maximum of 7 days with medium changed every other day. At the end of the culture period, blastocysts were scored based on morphological criteria as described for human embryos [20].
NT Procedures
Cell cultures of donor skin fibroblasts were established as described previously [21]. Briefly, a skin biopsy sample derived from a rhesus macaque female was washed in 0.5 mM EDTA in Ca2+- and Mg2+-free Dulbecco PBS (Invitrogen, Carlsbad, CA) and minced into pieces before incubation in Dulbecco modified Eagle medium (DMEM; Invitrogen) containing 1 mg/ml of collagenase IV (Invitrogen) at 37°C in 5% CO2 for 20 min. Tissue pieces were then vortexed, washed, and seeded into 75-cm3 cell culture flasks (Corning, Acton, MA) containing DMEM supplemented with 100 IU/ml of penicillin, 100 µg/ml of streptomycin (Invitrogen), and 10% FBS and then cultured at 37°C in 5% CO2. Fibroblasts for NT were synchronized in the G0/G1 phase of the cell cycle by culturing for 5 days after reaching 100% confluency.
Both NT and activation were performed as described previously [21]. Briefly, recipient MII oocytes were incubated for 5 min with 5 µg/ml of Hoechst 33342, transferred to 30 µl of TH3 containing 3.5 µg/ml of cytochalasin D, and incubated for 10–15 min before enucleation. The first polar body and approximately 10% of the underlying cytoplast were extracted by aspiration into an enucleation pipette. Enucleation was subsequently confirmed by absence of the metaphase spindle as determined by epifluorescent microscopy. A disaggregated donor fibroblast was aspirated into a micropipette and transferred into the perivitelline space of the cytoplast. Fusion of NT pairs was induced by two 50-µsec DC pulses of 2.7 kV/cm (Electro Square Porator T-820; BTX, Inc., San Diego, CA) in 0.25 M D-sorbitol buffer containing 0.1 mM calcium acetate, 0.5 mM magnesium acetate, 0.5 mM Hepes, and 1 mg/ml fatty acid-free BSA. Successful fusion was confirmed visually 45–60 min after electroporation by absence of the donor cell in the perivitelline space. Reconstructed embryos were activated 2 h after fusion by exposure to 5 µM ionomycin (CalBiochem, La Jolla, CA) for 2 min followed by a 4-h incubation in 2 mM 6-dimethylaminopurine. Fused and activated NT embryos were placed in HECM-9 and cultured as described above.
Monkey ES Cell Culture and Differentiation
The procedures for monkey ES cell culture have been described previously [22]. The monkey ES cell line ORMES-1 [23] was grown on feeder layers of mitotically inactivated mouse embryonic fibroblasts (MEF) in medium consisting of 80% DMEM with L-glutamine and glucose but without sodium pyruvate and supplemented with 20% FBS, 0.1 mM ß-mercaptoethanol, 1% nonessential amino acids (Invitrogen), and 2 mM glutamine (Invitrogen). Medium was changed daily, and ES cell colonies were split every 5–7 days by disaggregation in collagenase IV (1 mg/ml at 37°C for 3–5 min) and replating collected cells onto dishes with fresh MEF.
For embryoid body formation, entire ES cell colonies were loosely detached from MEF feeder cells by exposure to collagenase, rinsed in ES medium, and cultured in hanging drops of ES medium on the inner surface of 60-mm culture dish lids. Differentiation of ORMES-1 cells was also induced by inclusion of all-trans retinoic acid (RA; 1 µM) in ES medium for 3 days. Additionally, ES cells were directed to differentiate into neural progenitor cells (NPCs) as described previously [22].
Reverse Transcription-Polymerase Chain Reaction
Total RNA was extracted from individual, expanded blastocysts using the Absolutely RNA nanoprep Kit (Stratagene, La Jolla, CA) and from cell cultures using the RNeasy mini kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. The cDNAs were prepared using the Cloned AMV First-Strand cDNA Synthesis Kit (Invitrogen) according to the manufacturer's instructions. Polymerase chain reaction (PCR) primers (sense, GGACACCTGGCTTCGGATT; antisense, TTCGCTTTCTCTTT-CGGGC) for Oct-4 were designed based on human sequence (GenBank accession no. Z11898) using Vector NTI Suite 7.1 software (InforMax, Inc., Frederick, MD). The PCR was carried out in a 20-µl volume containing a final concentration of 1x AccuBuffer (Bioline USA, Inc., Randolph, MA), 1.5 mM MgCl2, 2 mM dNTP mix, 0.2 µM each primer, and 2.5 U of Accusure DNA polymerase (Bioline). The reaction was carried out at 94°C for 1.5 min followed by 35 cycles of 94°C for 30 sec, 67°C for 45 sec, and 68°C for 1.5 min. Positive-control PCR reactions were carried out using primers for glyceraldehyde-3-phosphate dehydrogenase (GAPDH; sense, ATGGGGAAGGTGAAGGTCGG; antisense, GGAGTGGGTGTCGCTGTTGAA). The PCR product was electrophoresed through a 2% Tris-borate-EDTA agarose gel stained with 0.1 µg/ml of ethidium bromide. Gels were visualized on a ultraviolet transilluminator and imaged using a Gel Doc 2000 (Bio-Rad, Hercules, CA). Sequence analysis was performed on the resulting PCR products to obtain the rhesus macaque sequence.
Immunocytochemical Analysis
Mouse and monkey oocytes and embryos were fixed in 4% paraformaldehyde for 20 min. At least 12 oocytes or embryos (from three replications) were sampled for each stage. The NT embryos were fixed at the morula/compact morula stage. After permeabilization with 0.2% Triton X-100 and 0.1% Tween-20, nonspecific reactions were blocked with 10% normal goat serum (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). Embryos were then incubated for 40 min in mouse monoclonal antibody (1:200) raised against a recombinant protein corresponding to amino acids 1–134 of human Oct-4 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Antibody specificity as defined by the manufacturer is for Oct-4 of mouse, rat, or human origin. After extensive washing, embryos were exposed to affinity-purified goat anti-mouse secondary antibody conjugated with indocarbocyanine (Cy3; Jackson ImmunoResearch). Embryos were then costained with 2 µg/ml of 4',6'-diamidino-2-phenylindole for 10 min, whole-mounted onto slides, and examined with epifluorescence microscopy. Monkey ES cells were plated on Lab-Tek II chamber slides (Nalge Nunc), fixed, and stained for stage-specific embryonic antigens, SSEA-3, SSEA-4, and alkaline phosphatase as described previously [22] and for Oct-4 as outlined above. The average number of ICM cells was calculated based on Oct-4 staining using MetaMorph 4.5 (Universal Imaging Co., West Chester, PA). Results (expressed as the mean ± SEM) were analyzed using one-way ANOVA and the Fisher protected least significant difference test with Statview software (SAS Institute, Inc., Cary, NC).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The presence of Oct-4 transcripts in monkey expanded blastocysts and ES cells was determined by reverse transcription-PCR. Oct-4 primers and cDNA isolated from six individual, expanded blastocysts or undifferentiated ES cells (ORMES-1) resulted in PCR products in the approximate size of 697 base pairs as expected for the human sequence (Fig. 1, lanes 1–7). No amplification products were obtained from differentiated ES cells (NPCs) and fetal fibroblasts, whereas control reactions for GAPDH mRNA were positive for all samples (Fig. 1, lanes 8 and 9). The PCR reactions carried out without cDNA were negative (results not shown). Sequence analysis performed on the resulting PCR products with Oct-4 primers revealed a 98.6% homology to the human sequence, with 11 mismatches out of 697 bases.
|
Oct-4 Protein in Mouse Oocytes and Preimplantation-Stage Embryos
The expression pattern of Oct-4 protein detected by immunocytochemistry in mouse preimplantation embryos was first examined to test antibody specificity. Control experiments with primary or secondary antibody alone were negative (data not shown). Oocytes (germinal vesicle [GV], metaphase I arrested [MI], and MII stages) showed a low level of cytoplasmic signal, whereas embryos at the 2- and 4-cell stages revealed no detectable signal (Fig. 2, A–C1). Signal localized to the nucleus was first seen at the transition between the 4- and 8-cell stages, with strong nuclear staining obvious at the 8-cell and morula stages, exclusive of nucleoli (Fig. 2, D–F1). In blastocysts, intense signal was associated with nuclei of the ICM. A weak, diffuse signal was also visible in TE cells of early and expanded blastocysts, but TE was negative in hatched blastocysts (Fig. 2, G–H1).
|
Oct-4 Expression Pattern in Rhesus Monkey Oocytes and Preimplantation Embryos
Similar to the mouse, immunocytochemical staining of whole-mounted rhesus monkey oocytes (GV, MI, and MII stages) detected a weak, diffuse signal. In GV and MI oocytes, Oct-4 protein was found throughout the cytoplasm, whereas in MII oocytes, signal was restricted primarily to the cell periphery (Fig. 3, A–B1). Oct-4 was not detected in zygotes or cleavage stage embryos up to the 8-cell stage (Fig. 3, C–D1). Nuclear staining first became obvious at the 16-cell stage, with strong signal observed in both morula and compact morula stages (Fig. 3, E–F1). In early blastocysts, both ICM and TE cell nuclei showed expression of Oct-4 that diminished in TE cells of expanded blastocysts and that disappeared from this cell type in hatched blastocysts (Fig. 3, G–I1).
|
In an effort to correlate noninvasive embryo quality assessment by microscopic evaluation with Oct-4 expression, expanded blastocyst-stage (Day 7) rhesus monkey embryos were graded before fixation based on a morphological determination of ICM presence and size. Two groups were evident: low grade (small or no visible ICM) and high grade (large, prominent ICM). Blastocysts were then fixed and stained for Oct-4, and the number of stained cells was quantified. The morphological evaluation criteria correlated (P < 0.05) with Oct-4 detection as low-grade blastocysts (n = 12) showed low ICM number (6 ± 1) when stained for Oct-4, whereas high-grade embryos (n = 8) exhibited high Oct-4-positive cell counts (34 ± 4). Low-grade, ICSI-produced expanded blastocysts lacking detectable ICM cells did not show Oct-4-positive cells when examined by immunocytochemistry (Fig. 3, J and J1).
Oct-4 Expression in Rhesus Monkey ES Cells
Monkey ES cells (ORMES-1) grown on mitotically inactivated, MEF feeder layers form distinctive, flat colonies of compact cells with high nuclear:cytoplasmic ratio and prominent nucleoli (Fig. 4A) and express cell surface antigens SSEA-3 and SSEA-4 as well as high alkaline phosphatase activity (results not shown) characteristic of undifferentiated ES cells [22–24]. Such cells were positive for Oct-4 protein expression, with signal localized in the nuclei exclusive of nucleoli, whereas nuclei of the surrounding feeder cells were negative (Fig. 4, B and B1). In contrast, monkey fetal fibroblasts and primary cultures derived from ovarian and uterine epithelial tissues did not express Oct-4 protein (results not shown). As a first step in differentiation, monkey ES cells were allowed to form embryoid bodies spontaneously in hanging drops. Oct-4 labeling performed on 3- to 5-day-old embryoid body showed partial expression of the protein (
20% of cells), with signal localized in the embryoid body core, whereas the peripheral cells were negative (Fig. 4, C and C1). When ES cells were also induced to differentiate by 3 days of exposure to RA, nearly complete loss of the undifferentiated ES cell phenotype was observed in the majority (70%) of colonies, and these cells were negative for Oct-4. However, the remaining colonies were characterized by cells in the center without signal, whereas cells localized to colony edges were positive (Fig. 4, D and D1). Control, nontreated ES cells continued to express strong Oct-4 protein throughout the colony (Fig. 4, E and E1).
|
Oct-4 Expression in Reconstructed Embryos
In an effort to monitor nuclear reprogramming, Oct-4 expression was examined in NT embryos reconstructed from adult skin fibroblasts. We reported previously that the majority of monkey somatic cell NT embryos exhibited developmental arrest at or somewhat beyond the 8-cell stage [21]. In the present study, despite high pronuclear formation and cleavage rates, most NT embryos arrested at the 8- to 16-cell stages (results not shown). A few embryos developed to morula/compact morula stages, but no blastocyst development was observed. Thirty-eight somatic cell NT embryos, ranging from 16-cell to morula/compact morula stages and having blastomeres with intact nuclei, were selected for Oct-4 expression analysis. Embryos with anucleated blastomeres or fragmented nuclei were eliminated from the analysis. Most of these NT embryos (n = 31) were negative for Oct-4 (Fig. 5, A and A1). Aberrant spatial distribution of nuclear signal among a few blastomeres was detected in some embryos (n = 3) (Fig. 5, B and B1). Four NT embryos displayed very low Oct-4 expression in all blastomeres (Fig. 5, C and C1). Donor fibroblasts used for NT were negative for Oct-4 (results not shown).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Contrary to the results presented here, analysis of Oct-4 expression patterns in bovine and porcine blastocysts revealed that Oct-4 is not restricted to the ICM; rather, the protein is present in both the ICM and TE of fully expanded, Day 8 blastocysts [13], with evidence of downregulation in TE cells first observed in bovine blastocysts at Days 14 and 16 [11]. Presumably, such differences in Oct-4 expression are related to interspecies variations in placentation and development. In the mouse, only polar (adjacent to the ICM) TE cells actively proliferate, whereas terminally differentiated mural TE cells are mitotically inactive and implantation occurs soon after hatching [29]. In contrast, bovine and porcine TE cells continue to proliferate long after hatching, producing blastocysts comprised of thousands of cells before implantation. Thus, delayed downregulation of Oct-4 in the TE of bovine and porcine blastocysts could reflect this prolonged period of preimplantation development. Clearly, Oct-4 is required for development and maintenance of totipotent and germline cells in the mouse. Cells losing Oct-4 during embryonic development differentiate into somatic lineages [6]. In addition, maintenance of Oct-4 expression within "normal" ranges appears to be crucial for pluripotent cell preservation [8], because increased or decreased Oct-4 expression triggers differentiation of mouse ES cells into endoderm/mesoderm or TE, respectively. The threshold for inducing differentiation, estimated at 50% above or below normal expression levels, suggests that Oct-4 must be tightly regulated to maintain the pluripotent phenotype.
The role of Oct-4 during embryogenesis has also been defined by inactivating the endogenous gene using knockout technology or short, interfering RNAs [9, 30]. Mouse embryos deficient in Oct-4 developed to blastocysts that lacked the ICM. Furthermore, in the absence of a true ICM, trophoblast proliferation was not maintained in Oct-4-/- embryos, although this capacity could be restored by an Oct-4 target gene product, fibroblast growth factor-4 [9]. Therefore, Oct-4 also determines paracrine growth factor signaling from stem cells to the TE.
Our morphological evaluation of expanded monkey blastocysts performed on living embryos correlated with the extent of Oct-4 labeling. If no ICM was discernible, no Oct-4-positive cells were found, suggesting the possibility of a differential cell-counting technique based on gene expression analysis rather than on spatial localization of cells. The ICM cell estimates (34 ± 4) obtained here for high-grade blastocysts were lower than those reported by us previously using confocal imaging and three-dimensional reconstruction (93 ± 10) for Day 8 blastocysts [31]. These variations may reflect differences in embryo age or culture conditions. Day 7 blastocysts grown in HECM-9 were analyzed in the present study, whereas Day 8 blastocysts cocultured with buffalo rat liver (BRL) cells in CMRL (Connaught Medical Research Laboratories; Life Technologies, Rockville, MD) medium were analyzed previously. Alternatively, cell-count differences may reflect the inclusion of polar TE cell nuclei in conventionally stained preparations, or perhaps not all ICM cell nuclei express Oct-4.
Although remarkable progress has been made in mammalian cloning by somatic cell NT [32–34], only a few reconstructed embryos are capable of supporting term development after transfer. Ideally, nuclear reprogramming results in immediate transcriptional silencing and subsequent establishment of temporal and spatial patterns of zygotic gene expression associated with normal development [35]. That is, a state of pluripotency should be acquired by the donor nucleus. As such, the appearance of Oct-4 expression may represent a quantifiable assay for the extent of reprogramming [36, 37]. We previously concluded that the failure of somatic, but not of embryonic, cell cloning in the monkey was secondary to incomplete reprogramming of the somatic cell nucleus [21]. The aberrant expression of Oct-4 seen in reconstructed embryos is consistent with that conclusion. Oct-4 controls the expression of several genes during early development, including FGF4, Sox-2, hCG, Utf-1, Rex-1, Opn, Esg-1, and other yet-unidentified downstream genes [3, 38, 39]. Thus, aberrant expression of Oct-4 in somatic cell NT embryos may be associated with the abnormal expression of other crucial genes, leading to developmental failure. When the pattern of Oct-4 expression was studied in cloned mouse blastocysts, only one-third of the NT embryos examined expressed Oct-4 exclusively in the ICM; the rest showed abnormal patterns [36]. Interestingly, the majority of cloned mouse embryos deficient in Oct-4 expression were able to develop to blastocysts despite the fact that true pluripotent ICM cells were absent [36, 37].
In summary, we demonstrated that Oct-4 expression patterns in monkey oocytes, preimplantation embryos, and ES cells are similar to those observed in the mouse. After differentiation of the TE at the hatched blastocyst stage, Oct-4 protein was localized in the ICM. Monkey ES cells expressed Oct-4 that was lost on differentiation, which is consistent with their pluripotent nature. Therefore, Oct-4 expression in the monkey, as in the mouse, provides a useful marker for pluripotency. Finally, lack of Oct-4 expression and the associated low blastocyst development in somatic cell NT embryos suggests that this crucial developmental gene is not appropriately reprogrammed and that it may serve as a marker of nuclear reprogramming.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence: Don Wolf, Oregon National Primate Research Center, Oregon Health & Science University, 505 NW 185th Ave., Beaverton, OR 97006. FAX: 503 533 2494; wolfd{at}ohsu.edu
Received: 16 May 2003.
First decision: 5 June 2003.
Accepted: 16 July 2003.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  S J Kimber, S F Sneddon, D J Bloor, A M El-Bareg, J A Hawkhead, A D Metcalfe, F D Houghton, H J Leese, A Rutherford, B A Lieberman, et al. Expression of genes involved in early cell fate decisions in human embryos and their regulation by growth factors Reproduction, May 1, 2008; 135(5): 635 - 647. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Byrne Generation of isogenic pluripotent stem cells Hum. Mol. Genet., April 15, 2008; 17(R1): R37 - R41. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.M. Mitalipov, Q. Zhou, J.A. Byrne, W.Z. Ji, R.B. Norgren, and D.P. Wolf Reprogramming following somatic cell nuclear transfer in primates is dependent upon nuclear remodeling Hum. Reprod., August 1, 2007; 22(8): 2232 - 2242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Rajesh, N. Chinnasamy, S. M. Mitalipov, D. P. Wolf, I. Slukvin, J. A. Thomson, and A. F. Shaaban Differential Requirements for Hematopoietic Commitment Between Human and Rhesus Embryonic Stem Cells Stem Cells, February 1, 2007; 25(2): 490 - 499. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yang, S. Yang, N. Beaujean, Y. Niu, X. He, Y. Xie, X. Tang, L. Wang, Q. Zhou, and W. Ji Epigenetic Marks in Cloned Rhesus Monkey Embryos: Comparison with Counterparts Produced In Vitro Biol Reprod, January 1, 2007; 76(1): 36 - 42. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Byrne, S. M. Mitalipov, L. Clepper, and D. P. Wolf Transcriptional Profiling of Rhesus Monkey Embryonic Stem Cells Biol Reprod, December 1, 2006; 75(6): 908 - 915. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Zhou, S.H. Yang, C.H. Ding, X.C. He, Y.H. Xie, T.B. Hildebrandt, S.M. Mitalipov, X.H. Tang, D.P. Wolf, and W.Z. Ji A comparative approach to somatic cell nuclear transfer in the rhesus monkey Hum. Reprod., October 1, 2006; 21(10): 2564 - 2571. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Cormier, S. Le Bras, C. Souilhol, S. Vandormael-Pournin, B. Durand, C. Babinet, P. Baldacci, and M. Cohen-Tannoudji The Murine Ortholog of Notchless, a Direct Regulator of the Notch Pathway in Drosophila melanogaster, Is Essential for Survival of Inner Cell Mass Cells. Mol. Cell. Biol., May 1, 2006; 26(9): 3541 - 3549. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-C. Fluckiger, G. Marcy, M. Marchand, D. Negre, F.-L. Cosset, S. Mitalipov, D. Wolf, P. Savatier, and C. Dehay Cell Cycle Features of Primate Embryonic Stem Cells Stem Cells, March 1, 2006; 24(3): 547 - 556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Fujimoto, S. M. Mitalipov, H.-C. Kuo, and D. P. Wolf Aberrant Genomic Imprinting in Rhesus Monkey Embryonic Stem Cells Stem Cells, March 1, 2006; 24(3): 595 - 603. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. C. Chang, H. Liu, J. Zhang, J. Grifo, and L. C. Krey Developmental incompetency of denuded mouse oocytes undergoing maturation in vitro is ooplasmic in nature and is associated with aberrant Oct-4 expression Hum. Reprod., July 1, 2005; 20(7): 1958 - 1968. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Cauffman, H. Van de Velde, I. Liebaers, and A. Van Steirteghem Oct-4 mRNA and protein expression during human preimplantation development Mol. Hum. Reprod., March 1, 2005; 11(3): 173 - 181. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Vejlsted, B. Avery, M. Schmidt, T. Greve, N. Alexopoulos, and P. Maddox-Hyttel Ultrastructural and Immunohistochemical Characterization of the Bovine Epiblast Biol Reprod, March 1, 2005; 72(3): 678 - 686. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. J. Downing and J. F. Battey Jr. Technical Assessment of the First 20 Years of Research Using Mouse Embryonic Stem Cell Lines Stem Cells, December 1, 2004; 22(7): 1168 - 1180. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Wolf, H.-C. Kuo, K.-Y. F. Pau, and L. Lester Progress with Nonhuman Primate Embryonic Stem Cells Biol Reprod, December 1, 2004; 71(6): 1766 - 1771. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kurosaka, S. Eckardt, and K. J. McLaughlin Pluripotent Lineage Definition in Bovine Embryos by Oct4 Transcript Localization Biol Reprod, November 1, 2004; 71(5): 1578 - 1582. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Pan, B. Qin, N. Liu, H. R. Scholer, and D. Pei Identification of a Nuclear Localization Signal in OCT4 and Generation of a Dominant Negative Mutant by Its Ablation J. Biol. Chem., August 27, 2004; 279(35): 37013 - 37020. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Miyamoto, K. Hayashi, T. Suzuki, S. Ichihara, T. Yamada, Y. Kano, T. Yamabe, and Y. Ito Human Placenta Feeder Layers Support Undifferentiated Growth of Primate Embryonic Stem Cells Stem Cells, July 1, 2004; 22(4): 433 - 440. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||
