Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print October 30, 2002.
Biol Reprod 2002, 10.1095/biolreprod.102.007476
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/4/1157    most recent
biolreprod.102.007476v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lapointe, J.
Right arrow Articles by Bilodeau, J.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lapointe, J.
Right arrow Articles by Bilodeau, J.-F.
Agricola
Right arrow Articles by Lapointe, J.
Right arrow Articles by Bilodeau, J.-F.
BIOLOGY OF REPRODUCTION 68, 1157–1164 (2003)
DOI: 10.1095/biolreprod.102.007476
© 2003 by the Society for the Study of Reproduction, Inc.

Female Reproductive Tract

Antioxidant Defenses Are Modulated in the Cow Oviduct During the Estrous Cycle1

Jérôme Lapointea,b, and Jean-François Bilodeau2,a,b,c

a Unité de Recherche en Ontogénie et Reproduction, Centre de Recherche du Centre Hospitalier de l'Université Laval, Sainte-Foy, Québec, Canada G1V 4G2 b Centre de Recherche en Biologie de la Reproduction, Université Laval, Sainte-Foy, Québec, Canada G1K 7P4 c Département d'Obstétrique et Gynécologie, Université Laval, Sainte-Foy, Québec, Canada G1K 7P4


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The balanced presence of reactive oxygen species and antioxidants has a positive impact on sperm functions, oocyte maturation, fertilization, and embryo development in vitro. The mammalian oviduct is likely to provide an optimal environment for final gamete maturation, sperm-egg fusion, and early embryonic development. However, the expression and distribution of antioxidant enzymes in the bovine oviduct are poorly characterized. We analyzed the mRNA expression and enzymatic activities of major antioxidants glutathione peroxidase (GPx), superoxide dismutase (Cu,ZnSOD), and catalase in the bovine oviduct throughout the estrous cycle. The high levels of expression for GPx-3 in the isthmus were in contrast to expression of GPx-1 and GPx-2, which occurred mostly in the ampulla and infundibulum of the oviduct. The highest levels of mRNA expression for GPx-1 were observed toward the end of the estrous cycle before ovulation, whereas GPx-2 was mostly expressed at midcycle. Catalase and Cu,ZnSOD mRNA analyses revealed a homogenous expression along the oviduct. The highest levels of glutathione and enzymatic activities for GPx and catalase occurred at the middle (10–12 days) and end (18–20 days) of the estrous cycle, whereas total SOD activity remained constant throughout the estrous cycle in the oviductal fluids. These findings underscore the importance of hydrogen peroxide and hydroperoxide removal by GPx in the oviduct. The heterogeneous expression of antioxidants such as GPx along the oviduct is a possible indication of their physiological role in the events leading to successful fertilization and implantation in vivo.

fallopian tubes, female reproductive tract, fertilization, oviduct, ovulatory cycle


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Successful fertilization and implantation rely on complex and progressive interactions among the maternal genital tract, gametes, and fertilized oocytes. The oviducts function as a sperm reservoir, a site of male gamete selection, and a site of fertilization in cows and other species [1–4]. Although reactive oxygen species (ROS: H2O2, O2-·, OH, NO) play an important role in male fertility/infertility, in vitro oocyte maturation, in vitro fertilization, and in vitro embryo development, little is known about the control of ROS levels by antioxidants in the oviduct in vivo [5–10].

The effects of ROS such as the superoxide anion (O2-·) and hydrogen peroxide (H2O2) on sperm functions are beneficial in some cases and detrimental in others. H2O2 blocks the motility of bovine sperm in vitro [11, 12], and ROS decrease sperm-oocyte penetration and block sperm-egg fusion in mice [13]. However, binding of sperm to the zona pellucida is promoted by low levels of ROS and is inhibited by antioxidants [14]. Thus, the way the female tract controls the generation of ROS could be a determining factor in successful fertilization and subsequent implantation.

ROS generation is controlled by enzymatic and nonenzymatic processes. Enzymatic defenses against O2-· include superoxide dismutases (SOD) that dismute O2-· to H2O2 [15]. Three forms of SOD exist in mammals; the main intracellular form is Cu,ZnSOD [15, 16]. The main enzymatic defenses against H2O2 include classic catalase, oviductal fluid catalase, and the family of glutathione peroxidases (GPx), which comprises five members [17–19]. GPx are able to metabolize H2O2 and lipid hydroperoxides. Four GPx (GPx1–GPx4) are dependent on selenium [17]. The main intracellular form of GPx is classic glutathione peroxidase or GPx-1 [18]. The principal extracellular form is GPx-3 (plasmatic GPx or eGPx) [20, 21]. GPx-2 is mainly found in the gastrointestinal tract [22], and expression of GPx-4 and GPx-5 has been reported in the testis and the epididymis, respectively [23, 24]. Other enzymes, such as the glutathione-S-transferases (GST), have peroxydatic activities similar to those of GPx [15]. Nonenzymatic antioxidants such as glutathione (GSH) play an important role in ROS neutralization. GSH is also a cofactor for GPx and GST [25].

The major antioxidants that control in vivo ROS levels in the oviduct remain to be characterized in cows and other species. A catalase in the bovine oviduct binds specifically to spermatozoa [26]. Previous studies also showed that oviductal fluid contains high-density lipoproteins, oviductal fluid albumin, {alpha}-, ß-, and {gamma}-globulin, glucose, and 25 free amino acids [27, 28]. Many proteins are glycosylated [29, 30]. Certain proteins, such as a 97-kDa protein, are regulated by the ovarian cycle [31, 32].

We characterized the mRNA expression of major antioxidant enzymes in the oviduct throughout the estrous cycle of the cow. The oviduct was divided into six equal sections for a better localization of the expression. We found different patterns of mRNA expression for GPx-1, GPx-2, GPx-3, Cu,ZnSOD, and catalase along the oviduct and throughout the estrous cycle. We also measured the main antioxidant enzymatic activities in the oviductal fluid and found that the highest levels occurred before ovulation.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Oviducts

Bovine oviducts were transported on ice from the slaughterhouse to the laboratory within 4 h. After examination by a veterinarian, animals showing genital tract anomalies were rejected according to the criteria documented by Arosh et al. [33]. The day of the estrous cycle was determined by visual examination of the ovaries [33]. Within 30 min, the oviducts were carefully dissected on an ice-cold glass plate to remove all blood vessels. The oviducts were then measured and processed.

Oviductal Fluid Retrieval

Oviductal fluid was recovered from each of two sections: the isthmus and the ampulla. The thick fluid was harvested by applying gentle pressure with a glass slide and making a gliding movement toward the end of a carefully dissected oviduct. The glass slide was passed only once to minimize trauma. The secretion was allowed to equilibrate in 1 ml of ice-cold PBS (Invitrogen, Carlsbad, CA) containing a protease inhibitor cocktail (1 mM EDTA, 0.5 mg/ml Leupeptin, 1.4 mg/ml Pepstatin A, 70 µg/ml PMSF; Boehringer Mannheim, Laval, PQ, Canada) for 20 min on ice. The mixture was centrifuged at 250 x g for 10 min at 4°C, and the resulting supernatant was recentrifuged at 1000 x g for 10 min at 4°C to remove all debris. Twenty percent glycerol was added in aliquots used to measure catalase. All samples were frozen in liquid nitrogen and stored at -86°C until analysis.

Preparation of the Oviduct for RNA Isolation

After the oviducts had been carefully dissected on ice, the whole oviduct including the infundibulum was measured and cut into six equal sections: 1) first isthmus section proximal to the uterotubal junction; 2) distal isthmus section; 3) middle section; 4) ampulla section distal to the infundibulum; 5) ampulla section proximal to the infundibulum; and 6) infundibulum. A small piece of the uterus adjacent to the first section of isthmus at the uterotubal junction was also collected. The tissues were rapidly frozen in liquid nitrogen and stored at -86°C until analysis.

Northern Blot Analysis

The RNA was extracted using TRIzol as described by the manufacturer (Invitrogen). The procedure for Northern hybridization and the description of the radiolabeled (32P) cDNA probes for GPx-1, Cu,ZnSOD, and catalase have been described elsewhere [18, 34, 35]. Polymerase chain reaction (PCR) primers were designed to produce a 405-base pair (bp) GPx-3 cDNA probe (corresponding to bases 79–474 of the bovine sequence, GenBank accession L10325). The forward and reverse primers were AGGGACAGGAGAAGTCGAAG and GGAGGACAGGAGTTCTTC, respectively. PCR primers to produce a GPx-2 cDNA probe were designed after analysis of identical regions of human (GenBank accession NM002083) and mouse (GenBank accession NM030677) cDNAs. The forward and reverse primers were CCCTCATGACCGATCCCAAGCTCA and TGCCATCATTCTGTGAAGGCCCAG, respectively, producing a GPx-2 cDNA probe of 420 bp. The forward and reverse primers to produce a 420-bp GPx-4 cDNA probe (based on GenBank accession AB017534) were CTCAAGCCAGCGCTACTCTG and CCTTGGGCTGGACTTTCATC, respectively. The bovine GPx-5 cDNA probe was kindly provided by Dr. Joel Drevet (Blaise Pascal University, Aubière cedex, France). PCR products were isolated by agarose gel electrophoresis, eluted, cloned, and sequenced.

Total RNA from all oviduct sections from a given animal were electrophoresed on the same gel and transferred to the same membrane. Twenty micrograms of total RNA was deposited per well, and electrophoresis was carried out in 1% agarose-formaldehyde gels and transferred to a BrightStar nylon membrane (Ambion, Austin, TX). The membrane was hybridized with a radiolabeled (32P) cDNA probe in Expresshyb solution as described by the manufacturer (Clontech, Palo Alto, CA). The membrane was exposed to X-OMAT film (Kodak, Rochester, NY). GPx-1, GPx-3, catalase, and Cu,ZnSOD hybridization signals were normalized to 18S rRNA hybridization signals obtained with a 5'-[32P]-labeled specific oligonucleotide [36]. Densitometry analysis was performed using AlphaImager 2000 software (Alpha Innotech, San Leandro, CA).

Western Blot Analysis

Protein samples from the isthmus and ampulla sections were boiled in Laemmli sample buffer containing 5% (v:v) 2-mercaptoethanol for 10 min, loaded (30 µg protein/track) on 12% polyacrylamide gels, blotted, and processed as previously described using polyclonal rabbit antibodies against bovine GPx-1 [18], catalase, and Cu,ZnSOD (Biomol Research Laboratories, Plymouth Meeting, PA).

Antioxidant Assays

The various samples of uterine and oviductal fluid were mixed with 5% 5-sulfosalicylic acid final (w/v) to reach a final concentration of proteins >10 mg/ml to assess glutathione. Oxidized GSH (GSSG) and total GSH (GSH + GSSG) were measured with the enzymatic recycling method described by Anderson [37]. The lysates were clarified by centrifugation at 1000 x g for 5 min. Glutathione reductase and glucose-6-phosphate dehydrogenase activities were assessed using commercially available kits (Sigma-Aldrich, Oakville, ON, Canada). GPx activities were determined by the standard indirect method using t-butyl hydroperoxide for seleno-GPx activity (Se-GPx) and cumene hydroperoxide (Sigma) for total GPx activity [34]. Total SOD activity was assessed using the nitroblue tetrazolium assay as described by Oberley and Spitz [38]. Catalase was measured using a spectrophotometric method [39]. The total protein content of the extracts used for the determination of the different specific activities was established using a commercially available bicinchoninic acid protein assay kit (Pierce, Rockford, IL).

Statistical Analysis

The statistical analysis for mRNA expression was performed on values from densitometry analyses normalized to corresponding 18S rRNA. Values reported are means ± SEM. All data were normally distributed and underwent equal variance testing. Model parameters included oviduct sections (seven sections from the uterotubal junction to the infundibulum), oviduct sides (ipsilateral vs. contralateral), and stages of the estrous cycle (Days 0–3, 10–12, and 18–20). The main effects of each parameter and the interactions between the parameters were determined. The experiments were analyzed with the general linear model of SPSS 10.0 for Windows (SPSS, Chicago, IL). Multiple means were compared by ANOVA, and when a significant effect was obtained the difference between means was determined by a Duncan multiple range test. A P value of <0.05 was considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Differential Antioxidant Gene Expression Along the Oviduct

We investigated the regional expression of five major antioxidant defenses in the oviduct using Northern blot assays for catalase, Cu,ZnSOD, GPx-1, GPx-2, and GPx-3 (Figs. 1–6). Six equal sections of the oviduct (including the infundibulum) and a section of the uterus near the uterotubal junction were examined. The ipsilateral and contralateral oviducts were analyzed separately on 10 animals (one pair of oviducts per animal). The data generated by the Northern analysis were normalized using 18S rRNA (represented as a normalized integrated optical density [IODn]). There were no significant interactions between ipsilateral and contralateral sides of the oviduct, the sections of the oviduct, and the stages of the estrous cycle. We pooled the data from both sides (contralateral or ispislateral) to represent mRNA levels for each antioxidant in oviduct sections at three stages of the estrous cycle in 10 animals because there was no effect of the oviduct side on mRNA expression (Figs. 1–6). Figure 1 shows catalase mRNA expression along the entire oviduct. No significant differences for this enzyme were detected between the different oviduct sections. We also found no significant difference in Cu,ZnSOD mRNA expression along the oviduct (Fig. 2).



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 1. Catalase (Cat) mRNA expression in oviduct sections throughout the estrous cycle. The mRNA levels in equal sections of the oviduct were analyzed by Northern blot. A) Representative autoradiograms for catalase expression at the beginning (Days 0–3), middle (Days 10–12), and end (Days 18–20) of the estrous cycle. B) Catalase expression for all sections of oviduct during the estrous cycle following densitometric measurements (IODn) and normalization with 18S rRNA expression levels. Ten pairs of oviducts were used (means of 10 animals). {block}, Data for Days 0–3; , data for Days 10–12; {square}, data for Days 18–20. The effect of estrous cycle on catalase expression was significant (P = 0.005)



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 2. Cu,ZnSOD mRNA expression in oviduct sections throughout the estrous cycle. The mRNA levels in equal sections of the oviduct were analyzed by Northern blot. A) Representative autoradiograms for Cu,ZnSOD expression at the beginning (Days 0–3), middle (Days 10–12), and end (Days 18–20) of the estrous cycle. B) Cu,ZnSOD expression for all sections of oviduct during the estrous cycle following densitometric measurements (IODn) and normalization with 18S rRNA expression levels. Ten pairs of oviducts were used (means of 10 animals). {block}, Data for Days 0–3; , data for Days 10–12; {square}, data for Days 18–20. The effect of estrous cycle on Cu,ZnSOD expression was not significant (P = 0.333)

The relative abundance of GPx-1 to GPx-5 mRNAs in the oviduct in comparison with other tissues is shown in Figure 3. The main GPx expressed are GPx-1 to GPx-3. In contrast to other GPx, GPx-4 was weakly expressed and GPx-5 was not detected (Fig. 3). Figure 4 shows that the strongest expression of GPx-1 was observed in the infundibulum followed by the ampulla. The weakest expression of GPx-1 was seen in the isthmus and at uterotubal junction (Fig. 4A). The expression of GPx-1 mRNA was 2-fold higher in the ampulla and infundibulum than in the isthmus. GPx-1 mRNA expression thus increased gradually from the isthmus to the infundibulum (Fig. 4B). As shown for GPx1, GPx-2 expression also increased 2-fold from the ithmus to the infundibulum (Fig. 5). In contrast to GPx-1 and GPx-2, GPx-3 mRNA expression was significantly stronger in the isthmus than in other oviduct sections (Fig. 6). These results suggest that GPx-1, GPx-2, and GPx-3 are differentially expressed along the oviduct.



View larger version (85K):
[in this window]
[in a new window]
  		FIG. 3. GPx-1 to GPx-5 mRNA expression in bovine oviduct and other tissues. The mRNA levels were analyzed by Northern blot, and representative autoradiograms for GPx-1 to GPx-5 are shown for various bovine tissues. Tracks containing oviduct and uterus RNA were constituted from a pool of RNA including equal parts of three stages of the estrous cycle. Homogeneous loading was confirmed by the analysis of 18S rRNA levels



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 4. GPx-1 mRNA expression in oviduct sections throughout the estrous cycle. The mRNA levels in equal sections of the oviduct were analyzed by Northern blot. A) Representative autoradiograms for GPx-1 expression at the beginning (Days 0–3), middle (Days 10–12), and end (Days 18–20) of the estrous cycle. B) GPx-1 expression for all sections of the oviduct during the estrous cycle following densitometric measurements (IODn) and normalization with 18S rRNA expression levels. Ten pairs of oviducts were used (means of 10 animals). {block}, Data for Days 0–3; , data for Days 10–12; {square}, data for Days 18–20. Means with different letters are significantly different (Duncan test). The effect of estrous cycle on GPx-1 expression was significant (P = 0.007)



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 5. GPx-2 mRNA expression in oviduct sections throughout the estrous cycle. The mRNA levels in equal sections of the oviduct were analyzed by Northern blot. A) Representative autoradiograms for GPx-2 expression at the beginning (Days 0–3), middle (Days 10–12), and end (Days 18–20) of the estrous cycle. B) GPx-2 expression for all sections of the oviduct during the estrous cycle following densitometric measurements (IODn) and normalization with 18S rRNA expression levels. Ten pairs of oviducts were used (means of 10 animals). {block}, Data for Days 0–3; , data for Days 10–12; {square}, data for Days 18–20. Means with different letters are significantly different (Duncan test). The effect of estrous cycle on GPx-2 expression was significant (P = 0.0001)



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 6. GPx-3 mRNA expression in oviduct sections throughout the estrous cycle. The mRNA levels in equal sections of the oviduct were analyzed by Northern blot. A) Representative autoradiograms for GPx-3 expression at the beginning (Days 0–3), middle (Days 10–12), and end (Days 18–20) of the estrous cycle. B) GPx-3 expression for all sections of the oviduct during the estrous cycle following densitometric measurements (IODn) and normalization with 18S rRNA expression levels. Ten pairs of oviducts were used (means of 10 animals). {block}, Data for Days 0–3; , data for Days 10–12; {square}, data for Days 18–20. Means with different letters are significantly different (Duncan test). The effect of estrous cycle on GPx-3 expression was not significant (P = 0.559)

Modulation of Antioxidant Gene Expression Throughout the Estrous Cycle

To assess the effect of hormonal status on the expression of these antioxidants, we analyzed oviducts from the beginning (Days 0–3), middle (Days 10–12), and end (Days 18–20) of the estrous cycle. The mRNA expression at the three stages of the estrous cycle is represented for each oviduct section by three distinct columns in the bar graphs (Figs. 1B, 2B, 4B, 5B, and 6B). No significant variations in mRNA expression were observed for Cu,ZnSOD and GPx-3 throughout the cycle (Figs. 2 and 6). However, a significant impact (P = 0.005) of the estrous cycle on catalase expression was observed (Fig. 1B). The highest expression for catalase mRNA was observed at the beginning of the cycle. GPx-1 expression increased (by 15–42%) in the different sections of the oviduct from the beginning to the end of the estrous cycle, and a significant effect (P = 0.007) of the estrous cycle on mRNA expression was observed (Fig. 4B). GPx-2 expression was also significantly affected (P = 0.0001) by the estrous cycle (Fig. 5B), and maximal expression was observed at the middle of the cycle.

Enzymatic Antioxidant Levels in the Oviduct

In the second part of the study, we determined the levels of GSH and the specific enzymatic activities of antioxidants. The oviduct was cut into two equal sections (isthmus and ampulla region) for more accurate localization of the antioxidants. As for mRNA expression, no significant differences in enzymatic activities for the ipsilateral and contralateral oviduct were observed (data not shown). Catalase activities from 10 pairs of cow oviducts at three stages of the estrous cycle are reported in Table 1. Specific catalase activity increased by about 2-fold during the cycle from Day 1 to Day 20. Catalase activity was very high and was estimated at 1 U/µl of secretion. The catalase activity in the fluid was partially correlated with the level of catalase found by immunoblot analysis in whole isthmus and ampulla sections of the oviduct. Catalase levels increased during the estrous cycle, specifically in the ampulla section of the oviduct (Fig. 7). However, neither specific enzyme activity nor protein level were correlated with mRNA expression (Table 1 and Figs. 1 and 7).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Enzymatic antioxidant activities and GSH levels in cow oviductal fluids.*



View larger version (49K):
[in this window]
[in a new window]
  		FIG. 7. GPx-1, catalase, and Cu,ZnSOD protein levels in isthmus and ampulla sections of the oviduct at three stages of the estrous cycle. Immunodetection of GPx-1, catalase, and Cu,ZnSOD at the beginning (Days 0–3), middle (Days 10–12), and end (Days 18–20) of the estrous cycle (results of one representative experiment are shown). I, Isthmus; A, ampulla

A slight but significant increase in SOD activity was observed from the beginning to the end of the estrous cycle in the isthmus region only (Table 1). In accordance with mRNA expression (Fig. 2), the level of Cu,ZnSOD remained constant in the oviduct throughout the estrous cycle (Fig. 7).

High GPx activity and GSH levels were detected in the oviduct, with as much as 1136 mU/mg of total GPx activity in the fluid (Table 1). Seleno-GPx activity accounted for >78% of total GPx activity. GPx activity almost doubled prior to ovulation; however, it was not clear which GPx was present in the oviductal fluids. The level of GPx-1 protein in the ampulla section increased at midcycle and remained high until the end of the estrous cycle (Fig. 7), which is in accordance with the higher GPx-1 mRNA expression found toward the end of the estrous cycle, especially in the ampulla (Fig. 4).

Both catalase and GPx detoxify H2O2, but GPx requires GSH to catalyze this detoxification [15, 40]. A significant increase in GSH (about 4-fold) was found toward the end of the estrous cycle (Table 1). Assuming a volume of 200 µl/oviduct, this represents a GSH concentration of about 17–133 µM.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We described an elaborate antioxidant defense system in oviductal tissues and fluids. Antioxidant genes are expressed differentially along the oviduct and, in the case of GPx-1, GPx-2, and catalase, are modulated during the estrous cycle. Oviduct sections from ipsilateral and contralateral sides were analyzed separately, but no differences in GPx-1 to GPx-3, catalase, and Cu,ZnSOD mRNA expression and distribution were observed. The proximity of the corpus luteum thus did not appear to affect the expression of antioxidant genes through the action of an unknown released factor. This finding was expected because only a few researchers have reported physiological or biochemical differences between ipsilateral and contralateral oviducts [32, 41]. However, in one study explants taken at estrus from the contralateral oviduct produced significantly higher levels of two 32-kDa polypeptides than did explants from the ipsilateral side [32].

In the present study, we observed heterogeneous regional expression of GPx genes along the oviduct. The mechanism for this heterogenous expression remains to be determined but may be related to the heterogeneity of the distribution of different cell types in the oviduct [42]. The expression of mRNA levels for GPx-1 and GPx-2 increased from the isthmus to the infundibulum. In contrast, GPx-3 expression was lower in the ampulla and higher in the isthmus, a region previously described as a sperm reservoir [3]. This finding may have physiological significance because it is well established that different reproductive events such as gamete maturation, fertilization, and early embryo development occur in different sections of the oviduct [43]. The regional physiological importance of the oviduct was well described in a study in which spermatozoa were preincubated in isthmic oviductal fluid and the oocytes were preincubated in ampullary oviductal fluid before fertilization. More oocytes were fertilized when spermatozoa and oocytes were incubated separately in isthmic and ampullary fluid, respectively, than when the combined oviductal fluid was used for both gametes [4].

The results from this study provide the first evidence of expression of GPx-1 and GPx-2 genes in a specific manner in the cow oviduct throughout the estrous cycle. Maximum expression of GPx-2 occurs at midcycle, whereas stronger GPx-1 expression is found at the end of the estrous cycle before ovulation. Antioxidant genes are not the only genes modulated during the estrous cycle. The mammalian oviduct is a steroid-responsive tissue, and hormonal changes that occur during the estrous cycle influence the physiology and secretory activities of ciliated and noncilliated cells of the epithelium [44–46]. Variations in mRNA expression during the estrous cycle were observed in the oviduct for different growth factors and receptors, such as insulin-like growth factor 1, fibroblast growth factor 1, and epidermal growth factor receptor, that may mediate the regional effects of steroid hormones in the oviduct [47–49]. Hormonal control of gene expression at the level of transcription thus occurs in the mammalian oviduct throughout the estrous cycle. The expression of GPx-5 mRNA in mouse epididymis is hormonally regulated via an androgen response element [50]. GPx-3 is also under the control of androgens [19]. Our results thus suggest that transcription of GPx is affected in vivo by variations in the hormonal status of the female reproductive tract. However, molecular mechanisms involved in this regulation remain to be identified and characterized.

There was no direct correlation between catalase mRNA expression and the 2-fold increase in catalase activity in the fluids from the beginning to the end of the estrous cycle. The secretion of protein is now thought to be selective in the oviduct, with the highest production of fluid occurring at estrus [28, 32, 51]. This high fluid production is in accordance with increased catalase activity and protein levels observed at the end of the estrous cycle, despite a slight decrease of catalase mRNA expression. In this study, we did not discriminate between classic catalase and oviductal fluid catalase mRNA expression.

The expression of GPx-1, GPx-2, and GPx-3 mRNAs was not correlated with enzymatic activities at all times along the oviduct. However, it was not possible to determine the contribution of each Se-GPx to this activity. Se-GPx activity increased gradually until the day of ovulation, in agreement with mRNA expression for GPx-1 and GPx-2 during the estrous cycle. We expected higher GPx activity in the isthmus where extracellular GPx (GPx-3) is mostly expressed. However, Se-GPx activity was homogeneous along the oviduct. Other GPx may be secreted specifically in the oviduct, and the technique employed for fluid retrieval may have precluded the detection of local variations of antioxidants; consequently, the results should be interpreted with care. Because fluids were taken from two sections of the oviduct, some mixing may have occurred during the procedure. Mixing also may occur naturally through the movement of the oviduct (contraction due to various stimuli such LH, endothelin-1, and prostaglandins) or the movement of ciliated cells in the infundibulum and ampulla [42, 52]. This mixing could have masked the local changes in GPx activity.

GSH is an important antioxidant in the oviduct and is a cofactor for GPx [53]. Our results indicated that GSH levels increased 4-fold from the beginning to the end of estrus in cow oviductal fluid. Both GPx activity and the cofactor GSH are thus present in the oviduct before ovulation to detoxify peroxides. Several studies have indicated that H2O2 could influence the crucial event of gamete fusion. H2O2 blocks motility of bovine sperm in vitro, induces premature acrosome reaction in rat sperm, and reduces the capacity of these sperm to penetrate the zona pellucida [11, 12, 54]. Our study emphasizes the importance of removing H2O2 and hydroperoxides, the substrates for catalase and GPx enzymes in the oviduct. These two classes of enzymes have different catalytic properties associated with various peroxides. The catalases are at their best when H2O2 concentrations are high, whereas GPx work better at lower concentrations of peroxide [14, 55]. Using horesradish peroxidase-luminol chemiluminescence, we were barely able to detect H2O2 production in the oviductal secretions, indicating that H2O2 removal is a very active process (unpublished results). More total protein, cholesterol, and especially phospholipids are secreted daily during the nonluteal phase [46]. Presence of phospholipids indicates the possibility of extensive toxic lipid peroxidation [14, 55]. Our results suggest that GPx may play a role in the prevention of oxidation of secreted phospholipids, because catalase cannot detoxify large peroxides.

This study is the first thorough investigation of a wide range of enzymatic antioxidants in the cow oviduct. The modulation of GPx-1 and GPx-2 mRNA levels during the estrous cycle suggests direct or indirect hormonal control by progesterone or estrogen [27, 52, 56]. This work also emphasizes the importance of GPx and the GSH cycle in the removal of peroxides during in vivo fertilization. In light of the results presented here, much more attention should be given to GPx as a factor for improving in vitro fertilization [40].


   ACKNOWLEDGMENTS
 
We thank Dr. Marc-André Sirard for the oviductal tissues and materials to test techniques used to retrieve antioxidants for the enzymatic assays, Dr. Marc-Edouard Mirault for antibodies against GPx-1, and Ms. Diana Cline for the revision of the manuscript.


   FOOTNOTES
 
1 This work was supported by grants from the Natural Sciences and Engineering Research Council of Canada (NSERC grant 238570-02) and the Centre de Recherche du CHUL. Back

2 Correspondence: Jean-François Bilodeau, Unité d'Ontogénie et Reproduction, CHUQ, Pavillon CHUL, Local T-1-49, 2705 Boul. W. Laurier, Sainte-Foy, PQ, Canada G1V 4G2. FAX: 418 654 2765; jean-francois.bilodeau{at}crchul.ulaval.ca Back

Received: 20 May 2002.

First decision: 15 June 2002.

Accepted: 11 October 2002.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Suarez SS, Brockman K, Lefebvre R. Distribution of mucus and sperm in bovine oviducts after artificial insemination: the physical environment of the oviductal sperm reservoir. Biol Reprod 1997 56:447-453[Abstract]
  2. Ignotz GG, Lo MC, Perez CL, Gwathmey TM, Suarez SS. Characterization of a fucose-binding protein from bull sperm and seminal plasma that may be responsible for formation of the oviductal sperm reservoir. Biol Reprod 2001 64:1806-1811[Abstract/Free Full Text]
  3. Lefebvre R, Chenoweth PJ, Drost M, LeClear CT, MacCubbin M, Dutton JT, Suarez SS. Characterization of the oviductal sperm reservoir in cattle. Biol Reprod 1995 53:1066-1074[Abstract]
  4. Way AL, Schuler AM, Killian GJ. Influence of bovine ampullary and isthmic oviductal fluid on sperm-egg binding and fertilization in vitro. J Reprod Fertil 1997 109:95-101[Abstract/Free Full Text]
  5. de Lamirande E, Jiang H, Zini A, Kodama H, Gagnon C. Reactive oxygen species and sperm physiology. Rev Reprod 1997 2:48-54[Abstract]
  6. Iwata H, Akamatsu S, Minami N, Yamada M. Effects of antioxidants on the development of bovine IVM/IVF embryos in various concentrations of glucose. Theriogenology 1998 50:365-375[CrossRef][Medline]
  7. Blondin P, Coenen K, Sirard MA. The impact of reactive oxygen species on bovine sperm fertilizing ability and oocyte maturation. J Androl 1997 18:454-460[Abstract/Free Full Text]
  8. Aitken RJ. The Amoroso Lecture—the human spermatozoon—a cell in crisis?. J Reprod Fertil 1999 115:1-7[Abstract/Free Full Text]
  9. Griveau JF, Le Lannou D. Reactive oxygen species and human spermatozoa: physiology and pathology. Int J Androl 1997 20:61-69[CrossRef][Medline]
  10. Riley JC, Behrman HR. Oxygen radicals and reactive oxygen species in reproduction. Proc Soc Exp Biol Med 1991 198:781-791[Abstract]
  11. Tosic J. Mechanism of hydrogen peroxide formation by spermatozoa and the role of amino-acids in sperm motility. Nature 1947 159:544
  12. Bilodeau JF, Chatterjee S, Sirard MA, Gagnon C. Levels of antioxidant defenses are decreased in bovine spermatozoa after a cycle of freezing and thawing. Mol Reprod Dev 2000 55:282-288[CrossRef][Medline]
  13. Mammoto A, Masumoto N, Tahara M, Ikebuchi Y, Ohmichi M, Tasaka K, Miyake A. Reactive oxygen species block sperm-egg fusion via oxydation of sperm sulfhydryl proteins in mice. Biol Reprod 1996 55:1063-1068[Abstract]
  14. Aitken RJ, Clarkson JS, Fishel S. Generation of reactive oxygen species, lipid peroxidation, and human sperm function. Biol Reprod 1989 41:183-197[Abstract]
  15. Yu BP. Cellular defenses against damage from reactive oxygen species [published erratum appears in Physiol Rev 1995; 75:preceding 1]. Physiol Rev 1994 74:139-162[Free Full Text]
  16. Heffner JE, Repine JE. Pulmonary strategies of antioxidant defense. Am Rev Respir Dis 1989 140:531-554[Medline]
  17. Brigelius-Flohe R, Aumann KD, Blocker H, Gross G, Kiess M, Kloppel KD, Maiorino M, Roveri A, Schuckelt R, Ursini F, Wingender E, Flohé L. Phospholipid-hydroperoxide glutathione peroxidase. Genomic DNA, cDNA, and deduced amino acid sequence. J Biol Chem 1994 269:7342-7348[Abstract/Free Full Text]
  18. Bilodeau JF, Mirault ME. Increased resistance of GPx-1 transgenic mice to tumor promoter-induced loss of glutathione peroxidase activity in skin. Int J Cancer 1999 80:863-867[CrossRef][Medline]
  19. Schwaab V, Faure J, Dufaure JP, Drevet JR. GPx3: the plasma-type glutathione peroxidase is expressed under androgenic control in the mouse epididymis and vas deferens. Mol Reprod Dev 1998 51:362-372[CrossRef][Medline]
  20. Takahashi K, Avissar N, Whitin J, Cohen H. Purification and characterization of human plasma glutathione peroxidase: a selenoglycoprotein distinct from the known cellular enzyme. Arch Biochem Biophys 1987 256:677-686[CrossRef][Medline]
  21. Martin-Alonso JM, Ghosh S, Coca-Prados M. Cloning of the bovine plasma selenium-dependent glutathione peroxidase (GP) cDNA from the ocular ciliary epithelium: expression of the plasma and cellular forms within the mammalian eye. J Biochem (Tokyo) 1993 114:284-291[Abstract/Free Full Text]
  22. Chu FF, Esworthy RS, Ho YS, Bermeister M, Swiderek K, Elliott RW. Expression and chromosomal mapping of mouse Gpx2 gene encoding the gastrointestinal form of glutathione peroxidase, GPX-GI. Biomed Environ Sci 1997 10:156-162[Medline]
  23. Ursini F, Heim S, Kiess M, Maiorino M, Roveri A, Wissing J, Flohe L. Dual function of the selenoprotein PHGPx during sperm maturation. Science 1999 285:1393-1396[Abstract/Free Full Text]
  24. Vernet P, Rock E, Mazur A, Rayssiguier Y, Dufaure JP, Drevet JR. Selenium-independent epididymis-restricted glutathione peroxidase 5 protein (GPX5) can back up failing Se-dependent GPXs in mice subjected to selenium deficiency. Mol Reprod Dev 1999 54:362-370[CrossRef][Medline]
  25. Meister A. Glutathione, ascorbate, and cellular protection. Cancer Res 1994 54:1969s-1975s[Medline]
  26. Lapointe S, Sullivan R, Sirard MA. Binding of a bovine oviductal fluid catalase to mammalian spermatozoa. Biol Reprod 1998 58:747-753[Abstract/Free Full Text]
  27. Ehrenwald E, Foote RH, Parks JE. Bovine oviductal fluid components and their potential role in sperm cholesterol efflux. Mol Reprod Dev 1990 25:195-204[CrossRef][Medline]
  28. Stanke DF, Sikes JD, DeYoung DW. Proteins and amino acids in bovine oviductal fluid. J Reprod Fertil 1974 38:493-496[Abstract/Free Full Text]
  29. Boice ML, Geisert RD, Blair RM, Verhage HG. Identification and characterization of bovine oviductal glycoproteins synthesized at estrus. Biol Reprod 1990 43:457-465[Abstract]
  30. Wegner CC, Killian GJ. Origin of oestrus-associated glycoproteins in bovine oviductal fluid. J Reprod Fertil 1992 95:841-854[Abstract/Free Full Text]
  31. Gerena RL, Killian GJ. Electrophoretic characterization of proteins in oviduct fluid of cows during the estrous cycle. J Exp Zool 1990 256:113-120[CrossRef][Medline]
  32. Malayer JR, Hansen PJ, Buhi WC. Secretion of proteins by cultured bovine oviducts collected from estrus through early diestrus. J Exp Zool 1988 248:345-353[CrossRef][Medline]
  33. Arosh JA, Parent J, Chapdelaine P, Sirois J, Fortier MA. Expression of cyclooxygenases 1 and 2 and prostaglandin e synthase in bovine endometrial tissue during the estrous cycle. Biol Reprod 2002 67:161-169[Abstract/Free Full Text]
  34. Mirault ME, Tremblay A, Beaudouin N, Tremblay M. Overexpression of seleno-glutathione peroxidase by gene transfer enhances the resistance of T47D human breast cells to clastogenic oxidants. J Biol Chem 1991 266:20752-20760[Abstract/Free Full Text]
  35. Crawford DR, Mirault ME, Moret R, Zbinden I, Cerutti PA. Molecular defect in human acatalasia fibroblasts. Biochem Biophys Res Commun 1988 153:59-66[CrossRef][Medline]
  36. Clements JA, Matheson BA, Wines DR, Brady JM, MacDonald RJ, Funder JW. Androgen dependence of specific kallikrein gene family members expressed in rat prostate. J Biol Chem 1988 263:16132-16137[Abstract/Free Full Text]
  37. Anderson ME. Determination of glutathione and glutathione disulfide in biological samples. Methods Enzymol 1985 113:548-555[Medline]
  38. Oberley LW, Spitz DR. Nitroblue tetrazolium. In: Greenwald RA (ed.), CRC Handbook of Methods for Oxygen Radical Research, 3rd ed. Boca Raton, FL: CRC Press; 1985:217–220
  39. Claiborne A. Catalase activity. In: Greenwald RA (ed.), CRC Handbook of Methods for Oxygen Radical Research, 3rd ed. Boca Raton, FL: CRC Press; 1985: 317–323
  40. Bilodeau JF, Blanchette S, Gagnon C, Sirard MA. Thiols prevent H2O2-mediated loss of sperm motility in cryopreserved bull semen. Theriogenology 2001 56:275-286[CrossRef][Medline]
  41. Friedman R, Lais T, Weber DW, Stormshak F. Responses of the bovine infundibulum to noradrenaline during the oestrous cycle. J Reprod Fertil 1994 101:311-315[Abstract/Free Full Text]
  42. Stalheim OH, Gallagher JE, Deyoe BL. Scanning electron microscopy of the bovine, equine, porcine, and caprine uterine tube (oviduct). Am J Vet Res 1975 36:1069-1075[Medline]
  43. Grippo AA, Way AL, Killian GJ. Effect of bovine ampullary and isthmic oviductal fluid on motility, acrosome reaction and fertility of bull spermatozoa. J Reprod Fertil 1995 105:57-64[Abstract/Free Full Text]
  44. Nayak RK, Ellington EF. Ultrastructural and ultracytochemical cyclic changes in the bovine uterine tube (oviduct) epithelium. Am J Vet Res 1977 38:157-168[Medline]
  45. Verhage HG, Fazleabas AT, Donnelly K. The in vitro synthesis and release of proteins by the human oviduct. Endocrinology 1988 122:1639-1645[Abstract]
  46. Killian GJ, Chapman DA, Kavanaugh JF, Deaver DR, Wiggin HB. Changes in phospholipids, cholesterol and protein content of oviduct fluid of cows during the oestrous cycle. J Reprod Fertil 1989 86:419-426[Abstract/Free Full Text]
  47. Schmidt A, Einspanier R, Amselgruber W, Sinowatz F, Schams D. Expression of insulin-like growth factor 1 (IGF-1) in the bovine oviduct during the oestrous cycle. Exp Clin Endocrinol 1994 102:364-369[Medline]
  48. Wollenhaupt K, Kettler A, Brussow KP, Schneider F, Kanitz W, Einspanier R. Regulation of the expression and bioactivation of the epidermal growth factor receptor system by estradiol in pig oviduct and endometrium. Reprod Fertil Dev 2001 13:167-176[CrossRef][Medline]
  49. Gabler C, Killian GJ, Einspanier R. Differential expression of extracellular matrix components in the bovine oviduct during the oestrous cycle. Reproduction 2001 122:121-130[Abstract]
  50. Lareyre JJ, Claessens F, Rombauts W, Dufaure JP, Drevet JR. Characterization of an androgen response element within the promoter of the epididymis-specific murine glutathione peroxidase 5 gene. Mol Cell Endocrinol 1997 129:33-46[CrossRef][Medline]
  51. Carlson D, Black DL, Howe GR. Oviduct secretion in the cow. J Reprod Fertil 1970 22:549-552[Abstract/Free Full Text]
  52. Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Gabler C, Acosta TJ, Nishimura M, Killian G, Sato K. In vitro regulation of local secretion and contraction of the bovine oviduct: stimulation by luteinizing hormone, endothelin-1 and prostaglandins, and inhibition by oxytocin. J Endocrinol 2001 168:117-130[Abstract]
  53. Gardiner CS, Salmen JJ, Brandt CJ, Stover SK. Glutathione is present in reproductive tract secretions and improves development of mouse embryos after chemically induced glutathione depletion. Biol Reprod 1998 59:431-436[Abstract/Free Full Text]
  54. Hsu PC, Hsu CC, Guo YL. Hydrogen peroxide induces premature acrosome reaction in rat sperm and reduces their penetration of the zona pellucida. Toxicology 1999 139:93-101[CrossRef][Medline]
  55. Ferrandi B, Lange Consiglio A, Carnevali A, Porcelli F. Spontaneous lipid peroxidation and sperm metabolism during incubation in media simulating the oviductal microenvironment. Cell Mol Biol (Noisy-le-grand) 1995 41:327-333
  56. Einspanier R, Gabler C, Kettler A, Kloas W. Characterization and localization of beta2-adrenergic receptors in the bovine oviduct: indication for progesterone-mediated expression. Endocrinology 1999 140:2679-2684[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
R. Talevi, M. Zagami, M. Castaldo, and R. Gualtieri
Redox Regulation of Sperm Surface Thiols Modulates Adhesion to the Fallopian Tube Epithelium
Biol Reprod, April 1, 2007; 76(4): 728 - 735.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. Lapointe, M. Roy, I. St-Pierre, S. Kimmins, D. Gauvreau, L. A. MacLaren, and J.-F. Bilodeau
Hormonal and Spatial Regulation of Nitric Oxide Synthases (NOS) (Neuronal NOS, Inducible NOS, and Endothelial NOS) in the Oviducts
Endocrinology, December 1, 2006; 147(12): 5600 - 5610.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
J. J. Salmen, F. Skufca, A. Matt, G. Gushansky, A. Mason, and C. S. Gardiner
Role of Glutathione in Reproductive Tract Secretions on Mouse Preimplantation Embryo Development
Biol Reprod, August 1, 2005; 73(2): 308 - 314.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. Lapointe, S. Kimmins, L. A. MacLaren, and J.-F. Bilodeau
Estrogen Selectively Up-Regulates the Phospholipid Hydroperoxide Glutathione Peroxidase in the Oviducts
Endocrinology, June 1, 2005; 146(6): 2583 - 2592.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
68/4/1157    most recent
biolreprod.102.007476v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lapointe, J.
Right arrow Articles by Bilodeau, J.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lapointe, J.
Right arrow Articles by Bilodeau, J.-F.
Agricola
Right arrow Articles by Lapointe, J.
Right arrow Articles by Bilodeau, J.-F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS